ID: 1167660924

View in Genome Browser
Species Human (GRCh38)
Location 19:50795584-50795606
Sequence CTGTAGAAGCTGAAACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167660924_1167660933 29 Left 1167660924 19:50795584-50795606 CCCTCCTGTTTCAGCTTCTACAG No data
Right 1167660933 19:50795636-50795658 TCTTGGTATGTTGGCCAGGTTGG No data
1167660924_1167660932 25 Left 1167660924 19:50795584-50795606 CCCTCCTGTTTCAGCTTCTACAG No data
Right 1167660932 19:50795632-50795654 GTTTTCTTGGTATGTTGGCCAGG No data
1167660924_1167660930 12 Left 1167660924 19:50795584-50795606 CCCTCCTGTTTCAGCTTCTACAG No data
Right 1167660930 19:50795619-50795641 CCTGGTTAATTTTGTTTTCTTGG No data
1167660924_1167660928 -6 Left 1167660924 19:50795584-50795606 CCCTCCTGTTTCAGCTTCTACAG No data
Right 1167660928 19:50795601-50795623 CTACAGGCGTGCACAATGCCTGG No data
1167660924_1167660931 20 Left 1167660924 19:50795584-50795606 CCCTCCTGTTTCAGCTTCTACAG No data
Right 1167660931 19:50795627-50795649 ATTTTGTTTTCTTGGTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167660924 Original CRISPR CTGTAGAAGCTGAAACAGGA GGG (reversed) Intergenic
No off target data available for this crispr