ID: 1167666574

View in Genome Browser
Species Human (GRCh38)
Location 19:50825933-50825955
Sequence GTCCCCCAGAGTCACCCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 2, 2: 5, 3: 21, 4: 149}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167666559_1167666574 20 Left 1167666559 19:50825890-50825912 CCCCAGGACACAATGCCCTGCAG 0: 1
1: 0
2: 6
3: 41
4: 427
Right 1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG 0: 1
1: 2
2: 5
3: 21
4: 149
1167666569_1167666574 -8 Left 1167666569 19:50825918-50825940 CCCCACAGACCAGGGGTCCCCCA 0: 1
1: 1
2: 4
3: 34
4: 297
Right 1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG 0: 1
1: 2
2: 5
3: 21
4: 149
1167666562_1167666574 18 Left 1167666562 19:50825892-50825914 CCAGGACACAATGCCCTGCAGGA 0: 1
1: 1
2: 1
3: 17
4: 183
Right 1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG 0: 1
1: 2
2: 5
3: 21
4: 149
1167666560_1167666574 19 Left 1167666560 19:50825891-50825913 CCCAGGACACAATGCCCTGCAGG 0: 1
1: 0
2: 3
3: 42
4: 305
Right 1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG 0: 1
1: 2
2: 5
3: 21
4: 149
1167666570_1167666574 -9 Left 1167666570 19:50825919-50825941 CCCACAGACCAGGGGTCCCCCAG 0: 1
1: 0
2: 7
3: 30
4: 300
Right 1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG 0: 1
1: 2
2: 5
3: 21
4: 149
1167666571_1167666574 -10 Left 1167666571 19:50825920-50825942 CCACAGACCAGGGGTCCCCCAGA 0: 1
1: 0
2: 2
3: 38
4: 302
Right 1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG 0: 1
1: 2
2: 5
3: 21
4: 149
1167666568_1167666574 -7 Left 1167666568 19:50825917-50825939 CCCCCACAGACCAGGGGTCCCCC 0: 1
1: 0
2: 4
3: 28
4: 286
Right 1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG 0: 1
1: 2
2: 5
3: 21
4: 149
1167666564_1167666574 4 Left 1167666564 19:50825906-50825928 CCTGCAGGATGCCCCCACAGACC 0: 1
1: 0
2: 2
3: 29
4: 263
Right 1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG 0: 1
1: 2
2: 5
3: 21
4: 149
1167666563_1167666574 5 Left 1167666563 19:50825905-50825927 CCCTGCAGGATGCCCCCACAGAC 0: 1
1: 0
2: 2
3: 18
4: 162
Right 1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG 0: 1
1: 2
2: 5
3: 21
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167666574 Original CRISPR GTCCCCCAGAGTCACCCTGT GGG Exonic
900746278 1:4362792-4362814 GTCCCCCAGTGTCACATTTTGGG - Intergenic
900868747 1:5287013-5287035 GTCCCCAAGATTCCCCCTGCTGG - Intergenic
901656925 1:10774705-10774727 TTCCCCAAGTGTGACCCTGTAGG + Intronic
902446283 1:16466752-16466774 GTCTCCCAATCTCACCCTGTAGG - Intergenic
903155427 1:21439574-21439596 GTCTCCCAGTCTCACCCTGTAGG - Intergenic
903461006 1:23521086-23521108 GCCCCCCAGTGTCAGTCTGTGGG + Intronic
904079609 1:27863701-27863723 GGCCCCCATGGTCACCCTGGTGG + Intergenic
904972981 1:34433625-34433647 GTCTCCCAGAGGTTCCCTGTGGG - Intergenic
905881122 1:41464427-41464449 GTTTCCCAGAGGCTCCCTGTGGG + Intergenic
915981940 1:160425791-160425813 GTGCCCCAGAGAAACCCTGTTGG - Exonic
917468701 1:175307570-175307592 GTCCCCCAGCCTCACCCCGGCGG - Intergenic
922043693 1:221922441-221922463 GTCCCCCAGAGTCAAGCCTTTGG + Intergenic
923464041 1:234232391-234232413 CTCCCCGGGAGTCACACTGTAGG + Intronic
924044407 1:240012430-240012452 GTCCCCCAGAGTTAGCATGCTGG - Intergenic
924604551 1:245521597-245521619 GACCCCCAGGCTGACCCTGTTGG + Intronic
1067794523 10:49311177-49311199 GACCTCCAGCGTCACCCAGTGGG + Intronic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1070719531 10:78746580-78746602 GTCCCCCAGAGGTTCGCTGTTGG + Intergenic
1072415879 10:95246449-95246471 GGCACCCAGGGTCACCCCGTAGG - Intronic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1078098229 11:8313408-8313430 GTCCCCCAGGGTCAGGCTCTGGG + Intergenic
1078474072 11:11615765-11615787 GTCTCCCAGACTCTGCCTGTAGG - Intronic
1083293005 11:61700154-61700176 GGCCCCCAGAGCCCTCCTGTTGG + Intronic
1083550889 11:63589552-63589574 GTCTCCCAGATTCACCCTTAGGG + Intronic
1083818338 11:65150741-65150763 GTCAGCCAGAGTCACCCTGCTGG + Intergenic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1085448115 11:76614796-76614818 GTCCCACAGAGGCTCCCAGTGGG + Intergenic
1085694358 11:78691261-78691283 GTCCTCCAGGGTCACGCTGCTGG - Intronic
1087203030 11:95365271-95365293 GACCCCCAAATTCACACTGTGGG + Intergenic
1087775527 11:102253315-102253337 GTCCCCCAGAGTTCACGTGTTGG - Intergenic
1092117327 12:6018768-6018790 GTACTCCACAGTCACCATGTAGG + Exonic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1100799762 12:98218886-98218908 GCACCTCAGAGTCATCCTGTGGG - Intergenic
1101759716 12:107648709-107648731 GCATCCCAGAGTCACCCTCTGGG + Intronic
1102241639 12:111328219-111328241 GTCCCACAGAGTCTGGCTGTGGG + Intronic
1103714327 12:122935218-122935240 GTCCCTGAGGGTGACCCTGTGGG + Intronic
1103848741 12:123917573-123917595 GTCCCCCACAGTCACGCTGAAGG + Exonic
1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG + Intronic
1107727951 13:43318950-43318972 GCCCCACAGAGTCAACCTGGAGG + Intronic
1111957687 13:94776210-94776232 GTCCCTCCGTGTCACCCTGAGGG - Intergenic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1115753970 14:36515726-36515748 GTCACCCAGTGTTACCCCGTTGG + Intergenic
1116871058 14:50069639-50069661 GGCCCCCAGATTGAACCTGTAGG + Intergenic
1117196054 14:53341199-53341221 TTCCCCAAGAGTCACCTTGTTGG - Intergenic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1124139840 15:27067551-27067573 GTGCTCCAGAGTGCCCCTGTGGG + Intronic
1124170316 15:27367014-27367036 GTCCCCCAGAGGCACCAAGGAGG + Intronic
1126038551 15:44569659-44569681 ATCCTCCAGAGGCCCCCTGTTGG - Intronic
1127213618 15:56801177-56801199 GTCTCCCAGAGTCCCCCAATGGG + Intronic
1128433961 15:67627064-67627086 GTCCTCTATAGTCCCCCTGTAGG - Intronic
1128918506 15:71589550-71589572 GGCCCCATGTGTCACCCTGTTGG + Intronic
1132704564 16:1237513-1237535 GCCCTCCCGAGTCACCCTGAGGG + Intergenic
1132706949 16:1248912-1248934 GCCCTCCCGAGTCACCCTGAGGG - Intergenic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1133344856 16:5063058-5063080 TTCCCACAGAGGTACCCTGTGGG + Intronic
1133804851 16:9117601-9117623 TGTCCCCAGAGTAACCCTGTAGG + Exonic
1134605306 16:15566301-15566323 GTCCCCCATGGCCACACTGTTGG + Intronic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1139257942 16:65561199-65561221 GTCCCCTGGAGCCACCCAGTAGG + Intergenic
1139385797 16:66569282-66569304 GTTCCCCAGACTAAGCCTGTTGG - Intronic
1139530794 16:67541813-67541835 ATCCCCCAGAGGCTCCCTGGGGG + Intronic
1139545865 16:67649247-67649269 GTCGTCCAGGGTCTCCCTGTGGG - Exonic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140472813 16:75224698-75224720 GGCCGCCAGAGTCGCCCTGTGGG - Exonic
1142270709 16:89088072-89088094 GTCCCCCAGGGCCATCCTGGAGG + Intergenic
1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG + Intergenic
1142925304 17:3231260-3231282 GTCCCCCAGAGCCACCATGTGGG - Intergenic
1143260534 17:5595273-5595295 GTCTCCCAAAGGCACCCAGTGGG - Intronic
1143573489 17:7776049-7776071 GTCCCGCAGGGTCACCCTCATGG - Exonic
1143662445 17:8334307-8334329 GTCACCCAGAGTTCCCCAGTGGG - Intergenic
1144522565 17:15963674-15963696 GTCTCCCAGAGTTCCCCTTTGGG - Intronic
1145118259 17:20232118-20232140 GGACCCCAGAGTCCCCGTGTTGG - Intronic
1151445452 17:74160687-74160709 GGGCCTCAGAGTCACCGTGTAGG - Intergenic
1151889428 17:76943428-76943450 GTGCCCAAGAGTCACCCGGGGGG + Intronic
1151979054 17:77498354-77498376 GTCCCCCAGGCCCACCATGTTGG - Intronic
1152291749 17:79443812-79443834 GAGCCCCAGAGTGACCCTCTGGG + Intronic
1152715886 17:81900480-81900502 GTCCCTCAGAGCCAGCCTGAGGG - Intronic
1157276484 18:46314367-46314389 GTCTCCCAGAGTTCCCCTGCAGG + Intergenic
1158351141 18:56566015-56566037 GTCCCCCAGAGTCCCCCCTGAGG + Intergenic
1160710672 19:549623-549645 GCCCGCCCGAGTCACCCTGCAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1163288850 19:16365578-16365600 GTCCCCCAGGGTGCCCCTGCCGG - Intronic
1165817379 19:38650329-38650351 GTGCCCCAGCCTCACCCTGTAGG - Intronic
1166147889 19:40849882-40849904 GTCCACCAGAGCCTCCCTGACGG + Exonic
1166152022 19:40881653-40881675 GTCCACCAGAGCCTCCCTGACGG + Exonic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167689695 19:50977676-50977698 GTCCCCCTGAGTCACCCTAGAGG + Exonic
1167695751 19:51014937-51014959 GGCCTCCAGAGTCACTCTGGGGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
926300547 2:11599101-11599123 GTCTCCCAGAGTCACAGGGTGGG + Intronic
930446172 2:51475111-51475133 TTCTCCCAGAGTCACCAGGTGGG + Intergenic
933664726 2:84955745-84955767 CTCTCCCAGGGTCACCCTGATGG + Intergenic
935704938 2:105848259-105848281 TTCCCCCAAAGTCACCCAGATGG + Intronic
937242056 2:120468205-120468227 GTCTCCCAGGAGCACCCTGTTGG + Intergenic
942449144 2:176098453-176098475 GTTCCCCAGAGCCACCCAATTGG + Intergenic
944269062 2:197760457-197760479 GCCCACCAGAGGCAGCCTGTGGG - Intronic
945245373 2:207712168-207712190 CTCCCCCAGAGTCCCCCGGGAGG + Intronic
947525328 2:230873809-230873831 ATTCCCCAGGGTGACCCTGTGGG - Intronic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
947907242 2:233774314-233774336 GGCTCCCAGAGTCACCCAGCAGG - Intergenic
1168813377 20:720680-720702 GGCCTGCAGAGTCACCCTCTAGG + Intergenic
1169566234 20:6856431-6856453 GACCCCCTGAGTAACCATGTTGG - Intergenic
1171186824 20:23128855-23128877 TTCCACCAGGGTCACCCAGTGGG - Intergenic
1171440874 20:25161953-25161975 GTCCCCCAGAGCCATCCTTCAGG + Intergenic
1173479438 20:43387689-43387711 GTTCCCCAGAGCTACCCAGTAGG - Intergenic
1176050053 20:63114315-63114337 GTCCCCCAGAGACACACTGGAGG + Intergenic
1178859760 21:36278974-36278996 CACCCCCAGGGTCACCCAGTGGG - Intronic
1179450928 21:41467871-41467893 GCCCTCCACTGTCACCCTGTGGG + Exonic
1179567078 21:42255975-42255997 GTCCCCCAGAGTGAACCAGCTGG + Intronic
1180196332 21:46196713-46196735 CTACTCCAGTGTCACCCTGTGGG + Intronic
1181400505 22:22647797-22647819 GTCCCCCAGAGTCCCCTTCCTGG - Intronic
1181648867 22:24247994-24248016 GTCCCCCAGAGTCCCCTTCCTGG + Intergenic
1181702484 22:24628895-24628917 GTCCCCCAGAGTCCCCTTCCTGG - Exonic
1182006300 22:26962418-26962440 GTCTCCCAGAGTCCTCCAGTGGG + Intergenic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
949177851 3:1088103-1088125 TTCCCCCACTGTCACCCAGTTGG + Intergenic
949494447 3:4618772-4618794 GTCCCACAGTGACACCATGTAGG - Intronic
954797309 3:53168172-53168194 GACCCCTGGAGTCAGCCTGTGGG + Intronic
958567993 3:95839079-95839101 GTTCTCCTTAGTCACCCTGTGGG - Intergenic
960589546 3:119352311-119352333 CACACCCAGAGGCACCCTGTGGG + Intronic
962365189 3:134774221-134774243 ATCACCCAGAGAGACCCTGTGGG - Intronic
964690482 3:159444190-159444212 GTCCCACACAGTCTCCCTGAGGG - Intronic
968814372 4:2814314-2814336 GTCCCACAGAGACACCCCATCGG - Intronic
970694405 4:18660052-18660074 GCCCCCAAAAGTCACCCTGCAGG - Intergenic
970937136 4:21586429-21586451 CTCCCCCAGTGTCTCCCTTTGGG + Intronic
973833641 4:54787781-54787803 GTGACCCACAGTAACCCTGTTGG + Intergenic
974831291 4:67192827-67192849 GACCCCAAGAGTCACACTGCCGG + Intergenic
974943459 4:68496636-68496658 GTCCTCCAGAGTCACCCTAAAGG - Exonic
978318530 4:107466986-107467008 GGCCCCCACAGTCACCTTGAGGG + Intergenic
978524596 4:109652731-109652753 GTCCCCCAGAGTCCATGTGTTGG - Intronic
985937741 5:3109709-3109731 GACCCCCAGATTCACCATGGAGG - Intergenic
989716405 5:44468347-44468369 GGCCCCAAGAGGCACCTTGTTGG + Intergenic
998514720 5:142742493-142742515 ATTCCCCAGAGTGTCCCTGTGGG + Intergenic
999674762 5:153987809-153987831 CTCTCCCAAAGTCACACTGTTGG - Intergenic
1005364262 6:25061478-25061500 GTCCTCCAGAGCTCCCCTGTGGG + Intergenic
1009686489 6:66964278-66964300 GTCACCCAGATTCACCCTTTAGG + Intergenic
1009950624 6:70391658-70391680 GTCCCCCAGAGTTCCCCAGCAGG + Intergenic
1009995420 6:70890311-70890333 CTGCCACAGAGTCTCCCTGTGGG + Intronic
1011416718 6:87129605-87129627 GGCCCCCAGAATCCCACTGTAGG + Intergenic
1013110513 6:107061205-107061227 ATCCACAAGAGTCACACTGTAGG + Intergenic
1019419605 7:944902-944924 GTCACCCAGAGTCACCCCCCCGG - Intronic
1022058578 7:26768065-26768087 GTCTCCCAGTGTCACTGTGTGGG + Intronic
1023912289 7:44564556-44564578 GTATCCCAGAGCCACCCTGATGG - Intergenic
1031910632 7:127513268-127513290 GTCTCCCAGAGGCCCCCAGTGGG - Intergenic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1036486380 8:9183256-9183278 GTGGCCCAGAGTGACTCTGTGGG + Intergenic
1036634310 8:10538469-10538491 GCCCCCCACTGTCACCCTGTGGG - Exonic
1038612657 8:29069988-29070010 GTCCCCCAGAGGCACTTTGCGGG + Exonic
1040329538 8:46378803-46378825 GTCCCCCAGAGTCCCCCCTGCGG - Intergenic
1040870954 8:52100176-52100198 GGCCCCCAGAGCTCCCCTGTCGG - Intergenic
1044720223 8:95138108-95138130 CTCCCCCAAAGTCACGCTTTTGG + Intronic
1047510697 8:125513190-125513212 TCCCCTCTGAGTCACCCTGTGGG - Intergenic
1048298011 8:133229179-133229201 CTCAACCAGAGTCACCCAGTTGG + Exonic
1048323013 8:133416272-133416294 GTCTCCCAGAGACACCCAATAGG + Intergenic
1048635345 8:136289450-136289472 GGCCCCCAGAGTTAGCCTGTCGG + Intergenic
1049275052 8:141716156-141716178 GTCCCCCAGACTCAGGCGGTCGG + Intergenic
1053362790 9:37501261-37501283 TTTCCCCAGAGTCACCGAGTTGG - Intronic
1056813143 9:89779982-89780004 CCCCACCAGAGTCTCCCTGTGGG - Intergenic
1057492744 9:95534518-95534540 GTTGCCCAGAGTCTCCCTGCAGG + Intergenic
1057528452 9:95823322-95823344 GTCCCTCAGAGTAAGCATGTGGG + Intergenic
1061808085 9:133147613-133147635 GTCCCCCAGAGGGACCCTGCCGG + Intronic
1062449537 9:136609736-136609758 GTCCCCCAGAGCCCATCTGTGGG + Intergenic
1186652612 X:11577352-11577374 GTCTCGCAGAGTCTCCCTGCAGG - Intronic
1187118243 X:16375575-16375597 GTCTCCCAGAGTTCCCCAGTGGG - Intergenic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1190810685 X:53880608-53880630 GTACCTCAGAGTCACTCTGTGGG + Intergenic
1195416247 X:104622621-104622643 GTCCCCCAGAGACACTATATTGG - Intronic
1195802278 X:108726371-108726393 GTCCCCCATACTCAACCAGTTGG + Intronic
1197749448 X:129954616-129954638 GGCGCCCAAAGTCACCCTGCTGG + Intergenic
1200204764 X:154307897-154307919 GCCCCCCAGAGACTCCCTTTTGG - Intronic