ID: 1167667787

View in Genome Browser
Species Human (GRCh38)
Location 19:50832790-50832812
Sequence GGTCAGAGAAGGCCTCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 897
Summary {0: 1, 1: 0, 2: 14, 3: 114, 4: 768}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167667787_1167667797 19 Left 1167667787 19:50832790-50832812 CCTCCTTGAGGCCTTCTCTGACC 0: 1
1: 0
2: 14
3: 114
4: 768
Right 1167667797 19:50832832-50832854 GTCTGCCTCCCCTACGAGACTGG 0: 1
1: 0
2: 3
3: 15
4: 128
1167667787_1167667790 -5 Left 1167667787 19:50832790-50832812 CCTCCTTGAGGCCTTCTCTGACC 0: 1
1: 0
2: 14
3: 114
4: 768
Right 1167667790 19:50832808-50832830 TGACCTCCCCTGACCCTCAGTGG 0: 1
1: 0
2: 3
3: 32
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167667787 Original CRISPR GGTCAGAGAAGGCCTCAAGG AGG (reversed) Intronic
900423551 1:2566159-2566181 AATCAGAGAAGACCTCACGGAGG - Intergenic
900598976 1:3495022-3495044 GTTCACAGAAGGCTTCACGGAGG + Intronic
900710569 1:4110839-4110861 GGTCAGAGAAGGCTTCAATGGGG - Intergenic
901703452 1:11057667-11057689 GGTCAGGGCAGGCCTCCAGGAGG - Intronic
901847269 1:11991388-11991410 GGTCAGAGAAGGCTTCCTGGGGG + Intronic
901872282 1:12145116-12145138 AGTCAGAGGAGGCCTCAGGCTGG - Intergenic
901908998 1:12439201-12439223 GGTCAGAAAAGGCCTGCAGGAGG - Intronic
902042934 1:13505721-13505743 GGTCAGGGAAGGCCTCTCGGAGG + Intronic
902079546 1:13811829-13811851 GGTCAGAGAAGGCCTCTTTCAGG + Intronic
902093734 1:13925421-13925443 GGTTGGAAAAGGCCTCAATGTGG + Intergenic
902178720 1:14671114-14671136 GGTCAGTGAAGGCTTCCTGGAGG + Intronic
902447869 1:16478541-16478563 GGTCAGGGAAGGCTTCCTGGAGG - Intergenic
902467775 1:16628765-16628787 GGTCAGGGAAGGCTTCCTGGAGG - Intergenic
902506804 1:16943963-16943985 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
902620797 1:17649759-17649781 GTTCAGAGATGGCCTCTTGGAGG + Intronic
902722296 1:18311990-18312012 GGTCAGGGAAGGCCTCTCTGGGG - Intronic
902811841 1:18892466-18892488 GGTCAGGGAAGGCCTCTCTGAGG + Intronic
902999916 1:20257956-20257978 GTTCAGAGAAGGCTTCCTGGAGG + Intergenic
903026995 1:20436478-20436500 GGTCAGAGAAGGCTTCCTGGAGG - Intergenic
903054630 1:20626990-20627012 GGTCAAAGAAGGCTTCCTGGAGG + Intergenic
903064628 1:20692264-20692286 GGTCAGGGAAGGCCTCTCTGAGG - Intronic
903266376 1:22160443-22160465 GGGCAGGGAAGGCCTCGTGGAGG - Intergenic
903274028 1:22209442-22209464 GGTCAGGGAAGGCCCCCGGGAGG + Intergenic
903322775 1:22552714-22552736 GTTCAGGGAAGGCTTCAAGGAGG + Intergenic
903655159 1:24944410-24944432 GACCAGAGAAGGCCTCTTGGAGG - Intronic
903926331 1:26833430-26833452 GGTCAGGGGAGACCTCTAGGAGG + Intronic
904404244 1:30275573-30275595 AATCAGAGGAGGCCTCATGGAGG - Intergenic
904470287 1:30731837-30731859 GGCCAGAGAAAGCCTCTTGGAGG - Intergenic
904499255 1:30904783-30904805 GGTCAGGGAAGGCTTCCTGGAGG - Intronic
904813220 1:33177516-33177538 GGTCAGGGAAGGCTTCACAGAGG + Intronic
905128241 1:35731244-35731266 GGTCAGAGAAGGCTTCTCTGAGG + Intronic
905363327 1:37435037-37435059 GGTCAGAGAAGGCTTCCTGGAGG - Intergenic
905447554 1:38036882-38036904 GGTCAGGGAAGGCCTCATGCAGG - Intergenic
905788150 1:40774347-40774369 GGTCTGCGGAGGCCACAAGGGGG + Intergenic
905831928 1:41076245-41076267 GGTCAGAGAAGTCCTCAATAAGG - Intronic
905878216 1:41447088-41447110 GCCCAGAGAAGGAGTCAAGGAGG - Intergenic
906159976 1:43640929-43640951 GGTCAGGGAAGGCTTCACTGAGG + Intergenic
906391272 1:45418958-45418980 GGTCAGGGAAGCCTTCTAGGAGG - Intronic
906655794 1:47547615-47547637 GGTCAGAGAAGGCTTCCCAGAGG - Intergenic
906706946 1:47901867-47901889 AATCAGAGAAGGCCTCACAGAGG + Intronic
906943976 1:50279880-50279902 GGTCAAAGAAGGCTTCCTGGAGG - Intergenic
907316490 1:53575888-53575910 GATCAAAGAGGGCCCCAAGGGGG + Intronic
907317466 1:53581642-53581664 AGTCAGGGAAGGCCTCCTGGAGG + Intronic
907445047 1:54502053-54502075 GGTCAGGGAAGGCCTCCCGGAGG - Intergenic
907526672 1:55057747-55057769 GGTCAGAGAAGGCATCTTGGAGG + Intronic
907786703 1:57619826-57619848 GGTCAGGGAGGACTTCAAGGAGG + Intronic
907981528 1:59486529-59486551 GGGCAGAGAAAGCCAGAAGGGGG - Intronic
908484193 1:64574040-64574062 GGACAGAGAAGGCTTCAAAGAGG + Intronic
908791499 1:67787211-67787233 GATCATAGAAGGCTTCCAGGAGG + Intronic
910591677 1:88933089-88933111 GGTCAGAAAAGGTCTTATGGAGG - Intergenic
911055382 1:93704134-93704156 GGTCAGAGAAGGCCTCTTTGTGG + Intronic
911487737 1:98523498-98523520 GGTCAGAGAAGGCTTCTCTGAGG - Intergenic
911566269 1:99466301-99466323 GGCCAGGGAAGACCTCAATGGGG + Intergenic
911766563 1:101683347-101683369 GGTCAGAAAATGCCTGCAGGAGG - Intergenic
912872906 1:113326476-113326498 GGTCAGAGAAGTCTTCCTGGAGG - Intergenic
913180188 1:116313306-116313328 GGTCAGGGAAGGCTTCCTGGAGG - Intergenic
913370100 1:118089183-118089205 GGTCAGAGAAGGCCTCTCTAAGG + Intronic
913789816 1:122505407-122505429 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913790930 1:122525131-122525153 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913794077 1:122581916-122581938 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913794959 1:122597561-122597583 CTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913797387 1:122640390-122640412 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913799987 1:122687653-122687675 TTCCAGCGAAGGCCTCAAGGAGG - Intergenic
913800064 1:122689012-122689034 TTTCAACGAAGGCCTCAAGGAGG - Intergenic
913801696 1:122718583-122718605 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913806596 1:122806979-122807001 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913812036 1:122904555-122904577 TGCCAACGAAGGCCTCAAGGAGG - Intergenic
913814788 1:122954201-122954223 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913817556 1:123003135-123003157 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913817575 1:123003475-123003497 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913821958 1:123081983-123082005 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913825573 1:123146734-123146756 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913829539 1:123218129-123218151 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913835312 1:123321422-123321444 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913837303 1:123356767-123356789 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913841030 1:123423369-123423391 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913842409 1:123447841-123447863 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913844219 1:123480633-123480655 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913844880 1:123492531-123492553 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913845110 1:123496611-123496633 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913846948 1:123530264-123530286 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913848856 1:123564591-123564613 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913855156 1:123677780-123677802 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913859903 1:123762921-123762943 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913861415 1:123789442-123789464 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913863128 1:123820190-123820212 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913866206 1:123875768-123875790 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913872077 1:123981287-123981309 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913876924 1:124067966-124067988 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913877338 1:124075440-124075462 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913891572 1:124330430-124330452 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913892468 1:124346411-124346433 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913897842 1:124442443-124442465 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913905983 1:124588580-124588602 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913914405 1:124739503-124739525 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
913915654 1:124761933-124761955 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
914319320 1:146544333-146544355 GGTCAGGAAAGGCCTCTATGAGG - Intergenic
916003712 1:160640030-160640052 GGTCAGAGGAGGCCTCTTGGAGG - Intronic
916342289 1:163749981-163750003 GGTCAGGGAAGGCCTTTTGGAGG - Intergenic
916659021 1:166903899-166903921 GGTCAGAGAAGGCCTCTCAAAGG - Intergenic
917063652 1:171067929-171067951 AGTTAGAGAAGGCCTCTAAGAGG - Intergenic
917310669 1:173674499-173674521 GGTTAGAGCAGTCCCCAAGGTGG + Intergenic
918087820 1:181260515-181260537 AGTCAGAGGAGGCTTCCAGGAGG + Intergenic
918318985 1:183346988-183347010 GGTCAAGGAAGGCTTCATGGAGG - Intronic
919711961 1:200738057-200738079 TGTCAGGGAAGGCTTCATGGAGG + Intergenic
919754442 1:201058115-201058137 GGTCAGAGAAGGCTTCATGGAGG - Intronic
920102612 1:203526792-203526814 GCTCAGCGAAGCCCTCAGGGAGG - Intergenic
920313760 1:205063747-205063769 GGTCAGAGAAGTCCTCTCTGAGG + Intronic
920724394 1:208420200-208420222 CATCAGAGAAGGCCTCCTGGAGG + Intergenic
921626778 1:217385998-217386020 GGACAGAGAAGTCCTTAAGCAGG + Intergenic
921642182 1:217568538-217568560 AGTCAGAGAATGCCTCAAACAGG + Intronic
922170890 1:223153527-223153549 GGTCAGGAAAAGCCTCAAGCAGG + Intergenic
922550229 1:226489254-226489276 GGTCAGGGAAGGCTTCTCGGAGG + Intergenic
922595740 1:226811359-226811381 GGTCAGGGAAGGCTTCAGGCTGG - Intergenic
923001128 1:230007263-230007285 GGTCAGAGAAGGGTGCAAAGTGG - Intergenic
923228032 1:231957320-231957342 GGTCAGGGAAGGCATCACTGGGG - Intronic
923821513 1:237448249-237448271 GGTCAAAGAAGTCATCAAAGGGG - Intronic
924044182 1:240011031-240011053 GGTCTGAAAAGGCCTCACTGAGG - Intergenic
924135233 1:240958816-240958838 GGTCAGAAAAGGTCTCATGAGGG - Intronic
1062784863 10:255741-255763 AGTGAAAGAAGGCCTCTAGGAGG + Intergenic
1064265063 10:13819403-13819425 GGTCAGGGAGGGCTTCATGGAGG - Intronic
1065030760 10:21583645-21583667 GGTGAGAGAAGGGAGCAAGGTGG + Intronic
1066203128 10:33160836-33160858 GGTCAGTGAAGACCTCTAAGAGG + Intergenic
1066284352 10:33950265-33950287 GGCCAAAGAAGGCCTCACTGAGG + Intergenic
1066330936 10:34421923-34421945 GGTCAGAGAAGGTCTCAGTGAGG + Intronic
1066446305 10:35486876-35486898 GATCAAAGAAACCCTCAAGGAGG - Intronic
1067158019 10:43799252-43799274 GGCCAGAGAAAGCCTCCAGAAGG + Intergenic
1067843657 10:49701696-49701718 GGGCAGGGCAGGCTTCAAGGAGG - Intronic
1068022595 10:51603821-51603843 GATCAGAGAAGGCCTCTTGGAGG + Intronic
1069064137 10:63924913-63924935 TGTCAGAGAAGGCTTCCTGGAGG + Intergenic
1069881266 10:71595368-71595390 GGTCAGGGAAGGCTTCCTGGGGG - Intronic
1069988412 10:72299201-72299223 AGTCAGGGAAGGCCTCACAGCGG + Intergenic
1072554156 10:96502066-96502088 GGACTGGGAAGGCCTCATGGGGG + Intronic
1072640591 10:97208215-97208237 GGAGAGAGAAGGCTTCTAGGGGG + Intronic
1073016259 10:100402006-100402028 GGTCAGAGAAGACTTCACAGAGG + Intergenic
1073221936 10:101881919-101881941 GGTCAGAAAAGGCCATACGGAGG - Intronic
1073540055 10:104310793-104310815 GATTAGGGAAGGCCTCATGGTGG - Exonic
1073662603 10:105493448-105493470 AGTCAGAGAAGGCCTCATCTGGG + Intergenic
1074034155 10:109721092-109721114 GTTCAGGGAAAGCCTCTAGGAGG - Intergenic
1074114780 10:110447542-110447564 GGTCAGGGAAGGCCTCAAAGAGG - Intergenic
1074203459 10:111259940-111259962 AGTCACAGAAGGCTTCCAGGAGG - Intergenic
1074782344 10:116811071-116811093 GGTCAGGGAAGGCTTCCTGGAGG + Intergenic
1074869839 10:117567917-117567939 GGTCAGGGAAGGCTTCCCGGAGG + Intergenic
1074883442 10:117676365-117676387 AGTCAGAGAAGGCTTCCTGGAGG - Intergenic
1074995515 10:118754546-118754568 GGACAGGAAAGGCCCCAAGGAGG - Exonic
1075932675 10:126312551-126312573 GGTCAGGGAAAGCTTCAGGGAGG + Intronic
1076104776 10:127812948-127812970 GGTTAGAGAAAGCTTCATGGAGG - Intergenic
1076480434 10:130781705-130781727 GATCAGGGAAGGCTTCCAGGAGG - Intergenic
1076896070 10:133312916-133312938 GGTCGGAGAAAGGCCCAAGGCGG - Exonic
1076987685 11:251087-251109 GGTCAGGGAAGGCCTCAGGGTGG - Intronic
1077113719 11:873341-873363 GGTCTTACAAGCCCTCAAGGGGG - Intronic
1077301312 11:1848434-1848456 GGGCAGGGAAGGCTTCGAGGGGG - Intergenic
1077614370 11:3664573-3664595 GGTCACAGAAGGCTTCCTGGAGG - Intergenic
1077844661 11:6012243-6012265 GCTCAGAGAAGACCTGAAGTGGG + Intergenic
1078087853 11:8244896-8244918 GGTCAGAGCAGGCTTTAAGGAGG - Intronic
1078143269 11:8706874-8706896 GGTCAGGGAAGGCCCCTGGGAGG + Intronic
1078163039 11:8858420-8858442 GGGCAGAGAAGGCCTCCCTGAGG + Intronic
1078196436 11:9140711-9140733 GATCAGAGAAGACTTCAGGGAGG - Intronic
1078535550 11:12170682-12170704 GGTCAGGGAAGGCTCCCAGGAGG - Intronic
1078781010 11:14439509-14439531 TATCTGTGAAGGCCTCAAGGAGG - Intergenic
1078912148 11:15742821-15742843 AGTCAGAGAAAGCTTCAAAGAGG + Intergenic
1079359431 11:19758330-19758352 GGTCAGGGAAGGCCTCTCTGAGG + Intronic
1080910199 11:36589140-36589162 GTTCAGAGAAGGCTTCTAGAGGG + Intronic
1081751291 11:45513015-45513037 TGTCAGAGTAGGTCTCAGGGAGG - Intergenic
1081947638 11:47012329-47012351 AGTCAGAGAAGGCCTCACTGAGG + Intronic
1082058225 11:47838149-47838171 GGTCAGGGAAGGCCTCAACAAGG + Intronic
1082260400 11:50073233-50073255 GGTCTGTGAAGGCCACAGGGAGG + Intergenic
1083190513 11:61048624-61048646 GGTCAGGGAAGGCTTCCTGGAGG - Intergenic
1083305935 11:61762040-61762062 AGTCAGAGATGGCCTCTTGGGGG + Intronic
1083432461 11:62621410-62621432 GGTCAGGGAAGGCCTCTCTGAGG + Intronic
1083664943 11:64269252-64269274 AGTCAGAGAGGGCTTCAGGGAGG - Intergenic
1083739957 11:64703748-64703770 GGTCAGGGAAGGCTTCAAGGAGG - Intronic
1083783826 11:64932632-64932654 GCTCAGATAAGCCCTGAAGGTGG + Intronic
1083807240 11:65082017-65082039 GGTCAGGGAAGGCCACTGGGGGG + Intronic
1084268739 11:68018113-68018135 GGTCAGTGCAGGTCTCCAGGCGG - Intronic
1084442028 11:69180037-69180059 TGTAAGTGAAGGCATCAAGGTGG + Intergenic
1084918212 11:72447476-72447498 GGTCAGAGAAGGCTTCCTGAAGG + Intergenic
1085426788 11:76411829-76411851 AGTCACAGAAGGGCTCATGGAGG - Intronic
1085497966 11:76989495-76989517 GATCAGAAAAGGCTTCAAGAAGG + Intronic
1085519485 11:77129722-77129744 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
1085652095 11:78277612-78277634 GGTAAAAGAATGCCTCAAGTGGG + Intronic
1085721401 11:78915245-78915267 GGTCAGAGAAGGCTTCCTGGAGG - Intronic
1085814012 11:79716726-79716748 GATGAGAGAGGGCCTGAAGGAGG + Intergenic
1086340297 11:85842279-85842301 GGTCAGAGAAGTCCTCACTCAGG - Intergenic
1086501804 11:87461455-87461477 GGTCAGGGAAGGCTTCCTGGAGG - Intergenic
1086915642 11:92527108-92527130 GGTCAGGGAGGGCTTCATGGAGG + Intronic
1087630438 11:100644517-100644539 GGTCAGAGGAGGCCTCCTGGAGG + Intergenic
1087677713 11:101181712-101181734 GGTCAGAGAAGCAGTGAAGGGGG + Intergenic
1087904610 11:103681140-103681162 GATCAGAGGAGGCTTCCAGGAGG + Intergenic
1088299605 11:108342554-108342576 GGTCAGTGAAGCACACAAGGGGG + Intronic
1088329616 11:108637365-108637387 GGTCAGAGAAGGCCACAGTAAGG + Intergenic
1088828338 11:113514678-113514700 GGTCAGGGAAGACTTCATGGAGG + Intergenic
1089456379 11:118628196-118628218 GGACAGAGATGGACTTAAGGGGG - Exonic
1089528475 11:119111943-119111965 GATCAGAGTAGGCTTCATGGAGG + Intronic
1089694094 11:120205840-120205862 GAGCAGGGAAGGCCTCATGGAGG + Intergenic
1090257719 11:125297515-125297537 AGTCAGAGAAGGCTTCCTGGAGG + Intronic
1090332407 11:125942204-125942226 AGCCAGGGGAGGCCTCAAGGGGG + Intergenic
1090353116 11:126120473-126120495 AATCAGGGAAGGCCTCCAGGAGG + Intergenic
1090397626 11:126429615-126429637 GGTCAGAGAAGACTTCTAGAAGG - Intronic
1091299736 11:134499961-134499983 AGTCAGAGGAGGCCTCTTGGAGG + Intergenic
1091458628 12:627463-627485 AATCAGAGAAGGCTTCATGGAGG + Intronic
1091797993 12:3308231-3308253 AGTCAGAGAAGGCTTCCTGGAGG + Intergenic
1092523779 12:9297316-9297338 GGTCAAAGAAGGCTTCCTGGAGG + Intergenic
1092543518 12:9434583-9434605 GGTCAAAGAAGGCTTCCTGGAGG - Intergenic
1092794454 12:12096052-12096074 GGGCAGATGAGGGCTCAAGGGGG - Intronic
1092974837 12:13734782-13734804 CGTCAGAGAAGGCTTCAGAGAGG + Intronic
1093778644 12:23107649-23107671 GGAAAGAGCATGCCTCAAGGGGG + Intergenic
1094313580 12:29113352-29113374 GCTCAGGGAAGGCTTCAAAGTGG - Intergenic
1094384700 12:29881494-29881516 GGTCAGAGAAGGCTTGACCGTGG + Intergenic
1094493998 12:30978144-30978166 AGTCAGAGAAGGCTTCCTGGAGG - Intronic
1094495919 12:30989271-30989293 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
1094500980 12:31020593-31020615 GCTCAGAGAAGGCTTCCTGGAGG + Intergenic
1094509426 12:31087473-31087495 GGTCAAAGAAGGCTTCCTGGAGG + Intronic
1095674054 12:44896117-44896139 TATCAGAGAAGGTCTCAATGTGG + Intronic
1095709250 12:45270474-45270496 AGTCAGAAAAGGCCTCCTGGAGG - Exonic
1095920333 12:47523545-47523567 GATCAGAGAAGAACTGAAGGAGG - Intergenic
1096150237 12:49305197-49305219 GGCCAGAGAAAGCTTTAAGGAGG + Intergenic
1096237978 12:49942692-49942714 AGTCAGAGAAGGCTTCCTGGAGG + Intergenic
1096424553 12:51490227-51490249 GGTCAGAGAAGGCTTCTCTGAGG + Intronic
1096967030 12:55636927-55636949 GGTCAGAGAATCCCAGAAGGAGG - Exonic
1097243204 12:57590540-57590562 GGTCAGGGAAGGCTTCAAAGAGG - Intergenic
1097277923 12:57825790-57825812 AGTCAGAGAAGGCTTCACAGAGG + Intronic
1098218058 12:68240606-68240628 GATCAGGGAAGGCCTCTTGGAGG - Intergenic
1098619610 12:72578483-72578505 GGACAGATAAGTCCTCAATGAGG - Intronic
1098694391 12:73534292-73534314 GGCCAGAGTAGGCCTCAAAGAGG - Intergenic
1098867999 12:75784207-75784229 GTTGTGAGAAGGCCTCAGGGGGG - Intergenic
1098992563 12:77079937-77079959 GGTCAGAGAAGACTTCACAGAGG - Intergenic
1099993212 12:89749313-89749335 GTTCAGGGAAGGCCTCACTGTGG - Intergenic
1100510902 12:95272294-95272316 GGTAAGAGAAGGCCTCTCTGAGG + Intronic
1100606433 12:96155549-96155571 AGTCAAGGAAGGCCTCAATGAGG - Intergenic
1101083962 12:101216223-101216245 GGTCAGAGAGGGCCTCTTGGAGG - Intergenic
1101255898 12:102976203-102976225 GATCAAAGAAGGCCTCCTGGAGG - Intergenic
1101736066 12:107464272-107464294 GGCCAGAGAAGGCCTCTATGAGG + Intronic
1102012479 12:109627154-109627176 GATCAGGGAAGGCTTCCAGGAGG + Intergenic
1102240504 12:111321868-111321890 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
1102248591 12:111370417-111370439 GGTCAGGGAAGGCCTCTCTGAGG + Intergenic
1102260055 12:111438074-111438096 GGTCAGAGAAGGCTCCCTGGAGG + Intronic
1102457019 12:113077301-113077323 GGTCAGCACAGGCCTCCAGGGGG - Intronic
1102557115 12:113734247-113734269 GGTCAGAAAAGGCCTCTCTGAGG + Intergenic
1102577503 12:113865333-113865355 GGTCACAGAAGGCCTCTTTGAGG - Intronic
1102648380 12:114418612-114418634 GGTCAGGGCTGGCCTCACGGAGG - Intergenic
1102995008 12:117342421-117342443 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
1103162303 12:118739667-118739689 GGTCAGGGAAGGCATCCTGGAGG + Intergenic
1103275103 12:119704749-119704771 ATCCAGAGAAGGCCTCAGGGAGG + Intronic
1103848841 12:123918089-123918111 GTTCAGAGATGGCCTCAGGTGGG + Intronic
1103932903 12:124460021-124460043 GGTCAGGGAAGGCCTCTGTGGGG - Intronic
1104258987 12:127165755-127165777 GGTCAGGGAAGGCTTCCTGGAGG + Intergenic
1104710569 12:130982843-130982865 GGACACAGAAGGACTCAGGGTGG + Intronic
1104717253 12:131024256-131024278 GGTCAGAGAGGCCCACATGGAGG + Intronic
1104762225 12:131304357-131304379 GGTCACATGAGGCCACAAGGAGG + Intergenic
1104763932 12:131314338-131314360 GGTCAGAGAAGCCTTCTTGGAGG - Intergenic
1104815563 12:131643718-131643740 GGTCAGAGAAGGTTTCCTGGAGG + Intergenic
1104817551 12:131656439-131656461 GGTCACATGAGGCCACAAGGAGG - Intergenic
1104842069 12:131830106-131830128 TGCCAGGGAAGGACTCAAGGTGG + Intronic
1104930233 12:132335102-132335124 GGGCACAGCAGGCCTCAGGGAGG + Intergenic
1105945349 13:25184982-25185004 GGTCACAAAAGGCTTCATGGAGG + Intergenic
1105958178 13:25303598-25303620 GGTCAGAAAAGGCCTCTCTGGGG - Intronic
1107646143 13:42496143-42496165 GGTCAGAGTAGGTCTCATTGAGG - Intergenic
1107659553 13:42625021-42625043 GTTCAGAGAGGGCTTCCAGGAGG + Intergenic
1108208198 13:48112498-48112520 GGCCAGAGAAGGCCTCTTTGAGG + Intergenic
1108581629 13:51833019-51833041 AATCAAGGAAGGCCTCAAGGAGG + Intergenic
1108670833 13:52686504-52686526 GGTCAGAGAAAGCCACATAGAGG + Intronic
1110577472 13:77075538-77075560 GGTCAGAGAAGGCTTCTTAGGGG - Intronic
1112195026 13:97217470-97217492 GGTCAAAGAAGGCTTCCTGGAGG + Intergenic
1112498239 13:99922488-99922510 GGTCAGGGAAGGCTTCAAAGAGG - Intergenic
1113723148 13:112576211-112576233 GGTCAGAACAGGCCTCAAATTGG + Intronic
1114526678 14:23370913-23370935 TGGCAGACATGGCCTCAAGGTGG - Intergenic
1115312146 14:31989789-31989811 AGTCAAAGAAGGCTTCATGGAGG + Intergenic
1117063190 14:51983413-51983435 GGTCAGAGGAGGCCTCATGGAGG - Intergenic
1117251163 14:53940128-53940150 CATCAGAGAAGGCCTCACTGGGG + Intergenic
1117982857 14:61358926-61358948 GGTCAGAGAAGGCTTCCTGGAGG - Intronic
1120159663 14:81131711-81131733 TGTCAGGGAAGGCCTCATTGAGG - Intronic
1120850203 14:89162887-89162909 GGTCAGCGGAGACCCCAAGGAGG - Exonic
1121050778 14:90817577-90817599 AGTCAGGGATGGCCTCACGGAGG + Intergenic
1121341281 14:93106573-93106595 GGTCAGAGAAGGCCTCTCTAAGG - Intronic
1121634828 14:95446800-95446822 GGTCAGGGAAGGCTTCCTGGAGG - Intronic
1122284351 14:100641992-100642014 GGTCAAAGAAGGCCTCCCTGAGG - Intergenic
1122297739 14:100714666-100714688 GTTCAGGGAAGCCCTCCAGGAGG + Intergenic
1122523963 14:102366914-102366936 GGTCAGAGAAGGCCTTTCTGTGG + Intronic
1123898426 15:24851376-24851398 GGACAAGGAAGGCCTCTAGGAGG + Intronic
1124888430 15:33709309-33709331 GATCAGAAAAGGCCTAATGGAGG + Intronic
1125211808 15:37225604-37225626 AGTCTGAGAAGGCCACCAGGAGG + Intergenic
1125604755 15:40933631-40933653 AGTCAGAAAAGGCTTCATGGAGG - Intronic
1125715941 15:41819952-41819974 CATCAGAGAAGAGCTCAAGGTGG + Intronic
1125759006 15:42084559-42084581 GGACAGAAATGGCCGCAAGGTGG - Intronic
1126447165 15:48760575-48760597 GGAAAGAGAAGGCCTCCTGGAGG + Intronic
1126451335 15:48811947-48811969 GGTCAGTGTAGGCATCATGGGGG - Intergenic
1126566733 15:50108681-50108703 GGTCAGAGAAGGCCTCCTAAAGG - Intronic
1126679347 15:51188473-51188495 GGTCAGGGAAGGCCTCATTTAGG - Intergenic
1127384454 15:58456031-58456053 GGTCTGAGAAGGCTTCATGGGGG + Intronic
1127841660 15:62837194-62837216 GGTCAGAGAGGGACTCAAGAGGG - Intronic
1127905728 15:63374358-63374380 GGTCAGGGAAGGCCTCCTGGAGG - Intronic
1127977597 15:64009633-64009655 GGTCAGGGAAGACTTCCAGGAGG - Intronic
1128137852 15:65277249-65277271 GGTCAGGGAAGGCTTCACGTGGG - Intronic
1128334592 15:66777885-66777907 GGGCAGGCAAGGCCTGAAGGCGG + Intronic
1128432294 15:67608584-67608606 GATCAGGAAAGGCCTCATGGAGG + Intronic
1128473992 15:67981511-67981533 GATCAGAGAAGGCTTCCTGGAGG - Intergenic
1128515377 15:68338764-68338786 GGTCCGAGGAGGCCTCAATGAGG + Intronic
1128550260 15:68593822-68593844 GGTCAAGGAAGGCTTCATGGAGG + Intronic
1128787661 15:70410234-70410256 GGTCAGGGAAGGCCCCACAGAGG + Intergenic
1129268714 15:74408489-74408511 GGACAGAGAAGGGAACAAGGGGG + Intergenic
1129379046 15:75154126-75154148 AGTCAGAGAAGGCTTCGTGGTGG + Intergenic
1129470830 15:75752457-75752479 GGTCAGTGAAGGCCATAATGAGG + Intergenic
1129700061 15:77762737-77762759 GGTCAGGGAAGGCTTCATGGAGG - Intronic
1129791115 15:78341173-78341195 GGTCGGAGAAGGCTTTGAGGAGG + Exonic
1130074854 15:80679877-80679899 AGTCAGAAAAGGCTTCAAGAAGG - Intronic
1130125426 15:81089899-81089921 GGTGAGAGACACCCTCAAGGAGG + Intronic
1130353276 15:83109186-83109208 GGCCAGGGAAGGCTTCTAGGAGG + Intronic
1130513112 15:84605391-84605413 GGTCAGAGAAGGCTTCCTGGAGG + Intronic
1130614330 15:85390307-85390329 GGTCAGACAAGGCCTTACTGAGG + Intronic
1130663761 15:85852312-85852334 AGTCAGAGAAGGCTTCCAGCAGG + Intergenic
1131018534 15:89078065-89078087 GGTCAGAGATGATCCCAAGGTGG - Intergenic
1131095602 15:89652678-89652700 CCTCGAAGAAGGCCTCAAGGAGG + Exonic
1131256462 15:90865896-90865918 GGTCAGGGAAGACCTCTGGGAGG - Intergenic
1131813532 15:96199142-96199164 GGTCAGGGAAGGCCTCTCTGGGG - Intergenic
1131825885 15:96322346-96322368 GGGGGGAGCAGGCCTCAAGGGGG - Intergenic
1132288173 15:100680941-100680963 GGTCAGAGAAGGCTTCCTGCAGG - Intergenic
1132701398 16:1223651-1223673 GGTCAGGGAAGGCTTCATGGAGG - Intronic
1133813802 16:9181219-9181241 GGTCAGAGAGGGCTTCCTGGAGG + Intergenic
1134019802 16:10913612-10913634 GGTCAGAAAAGACCTCACTGAGG - Intronic
1134046299 16:11103603-11103625 GGTCAGAGAAGGCTTCTTGCAGG - Intronic
1134092794 16:11400360-11400382 GGTCAGTGAGAGCCTCATGGGGG - Intronic
1134093524 16:11404122-11404144 GGTCTGGGAAGGCCTCTTGGAGG - Intronic
1134094626 16:11411338-11411360 GGAAAGAGAAGGCCTGAAGCTGG + Intronic
1134101026 16:11451664-11451686 GGTCAGCAAAGGCTTCTAGGAGG + Intronic
1134125562 16:11613611-11613633 AGTCAGGGAAGGCTTCCAGGAGG + Intronic
1134475203 16:14567665-14567687 GGTCAGGGAAGGCAGGAAGGAGG - Intronic
1134655682 16:15946858-15946880 AGTCAGAGAAGGCTTCCTGGAGG - Intergenic
1134769893 16:16799090-16799112 GGTGAGAGAAGACATCAAGGGGG - Intergenic
1134834049 16:17346600-17346622 GGTCAGAGATGGCCACGAGGAGG + Intronic
1134979296 16:18594187-18594209 GATCAAAGAAGGCCTCCTGGCGG - Intergenic
1135563971 16:23497667-23497689 GGTCAGAGAAGTCTTTAGGGTGG - Intronic
1135726107 16:24854898-24854920 AGTGAGAGAAGGCCTAGAGGTGG - Intronic
1136067902 16:27771043-27771065 GCTCTGGGAAGGCCTCCAGGAGG - Intronic
1136238119 16:28927202-28927224 GATCAGGGAAGGCCTCACTGAGG - Intronic
1136459672 16:30401814-30401836 GGTCAGAGTAGGCTTCTTGGAGG - Intergenic
1136578265 16:31137013-31137035 GGCCAGAGTGGCCCTCAAGGAGG - Intergenic
1136783920 16:32923709-32923731 GGCCAGAGAAGGCCTCGCTGAGG + Intergenic
1136885863 16:33930097-33930119 GGCCAGAGAAGGCCTCGCTGAGG - Intergenic
1137039558 16:35598034-35598056 GGTCGGTGAAGGCCACAAGAAGG - Intergenic
1137260398 16:46823137-46823159 GGTTAGAGAAGGCCCCTATGAGG - Intronic
1137405467 16:48185783-48185805 AATCTGGGAAGGCCTCAAGGTGG - Intronic
1137607555 16:49796678-49796700 GGTCAGAGGAGGCCTCTAGTAGG + Intronic
1137753977 16:50887043-50887065 GGTCAGGGAAGGCCTCCCTGGGG + Intergenic
1137812640 16:51367469-51367491 GGTCAGAGAAGGCCTCACAGAGG + Intergenic
1138026208 16:53524184-53524206 TGTCAGAGAAGCCCCCGAGGAGG - Intergenic
1138217626 16:55218412-55218434 GGACTGAGTAGGCTTCAAGGAGG + Intergenic
1138309106 16:56008143-56008165 GGCCAGGGAGGGCTTCAAGGAGG + Intergenic
1138507295 16:57484740-57484762 AGTCAGGGAAGGCCTCCTGGAGG - Intronic
1138567183 16:57841969-57841991 GGTCAGGGAAGGCCTCTCCGAGG - Intronic
1138657985 16:58501612-58501634 GGTGAGAGAAGGCGTTAGGGAGG + Intronic
1139364108 16:66423037-66423059 GGTCAGAAAAGGCCTCTTTGAGG - Intergenic
1139526988 16:67522901-67522923 GGTCAGGGAAGGCCTCTTTGAGG - Intronic
1139607190 16:68027768-68027790 GGTCAGAGAAGGCTTCCAGGAGG + Intronic
1140014204 16:71165751-71165773 GGTCAGGAAAGGCCTCTATGAGG + Intronic
1140241257 16:73203034-73203056 GATCAGGGAAGGCTTCCAGGAGG - Intergenic
1140352290 16:74273641-74273663 TGTCAGGGAAGGCCTCACCGGGG - Intergenic
1140843844 16:78867780-78867802 GGTCAGAAAAGGCCTCAGATTGG - Intronic
1140886335 16:79247104-79247126 GGTCAGGGAAGGCCTCCCCGAGG + Intergenic
1141097075 16:81170534-81170556 GGTCAGAGAAGACCCCCAGAAGG + Intergenic
1141189944 16:81817183-81817205 GGTCAGAAAAGGCCTCTCTGAGG + Intronic
1141876629 16:86829346-86829368 GGTCAGGGAAGGCTTCCTGGAGG + Intergenic
1142493365 17:292875-292897 AGTCACAGAAGGCCCCAAGGAGG + Intronic
1143111592 17:4555935-4555957 GGTCAGGGAAGGCCTCTGTGAGG + Intergenic
1143145075 17:4769984-4770006 GGTCTGAGTGGGCCGCAAGGAGG + Intergenic
1143339903 17:6202728-6202750 GGTCAGGGAAGGCTTCATAGAGG - Intergenic
1143410103 17:6703529-6703551 GGTCAGAAAAGGCCTCCTTGAGG + Intronic
1143517580 17:7427448-7427470 GTGCAGAGAGGGCCTCAAGGTGG - Exonic
1143874387 17:9980840-9980862 GGTCAGGGAAGGCTTCTTGGAGG + Intronic
1144403077 17:14925579-14925601 GGTCAGGGATGGCTTCATGGTGG + Intergenic
1144636235 17:16911012-16911034 GGTCAGAGATGGCTTCCTGGAGG + Intergenic
1144697481 17:17314858-17314880 GGTCAGGGAAGGCCTCTGTGAGG - Intronic
1144750103 17:17642641-17642663 GGTCAGAGAAGGCCTTACCAAGG - Intergenic
1145259790 17:21347808-21347830 GGTCAGGGAAGACCTCCTGGAGG + Intergenic
1145316825 17:21740130-21740152 GGTCAGGGAAGACCTCCTGGAGG - Intergenic
1145784367 17:27584514-27584536 AGTCAGAGGAGGCCTCACAGTGG + Intronic
1145881332 17:28354798-28354820 GGTCAGGGAAGGCTTCCTGGAGG - Intronic
1145974590 17:28976871-28976893 GGTCAGGGAAGGCTTCCTGGAGG - Intronic
1145987942 17:29060238-29060260 GGTCAGAGGAGGACTCACAGAGG + Intergenic
1146499985 17:33355977-33355999 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
1146519547 17:33515617-33515639 GGTCAGACAAGGCCTGGAAGAGG - Intronic
1146522547 17:33537350-33537372 GCTCAAGGAAGGCCTCTAGGAGG - Intronic
1146651633 17:34610530-34610552 GGTCAAGGAAGGCTTCAAAGAGG + Intronic
1146653345 17:34620780-34620802 TATCAGCGAAGGCTTCAAGGAGG + Intronic
1147144196 17:38475865-38475887 GGCCAGAGAAGGCCTCACTGAGG + Intronic
1147282431 17:39373126-39373148 GGTCAGAAAAGGTTTCATGGAGG - Intronic
1147314535 17:39613256-39613278 GGTCAGGGAAGGCTCCCAGGAGG - Intergenic
1147566130 17:41537396-41537418 GGTCAGGGAAGGCCTCTCTGAGG + Intergenic
1148146117 17:45366183-45366205 GGTCAAGGAAGGCTTCATGGAGG + Intergenic
1148385364 17:47230626-47230648 GGTCAGGGAGGGCTTTAAGGAGG + Intergenic
1148698208 17:49573722-49573744 GGTCAGAGATGGCTTCCTGGAGG - Intergenic
1148732712 17:49847202-49847224 GCTCAGGGAAGGCTTCCAGGGGG - Intronic
1148854229 17:50569912-50569934 CGTCAGAGAAGGGCTCAGTGGGG + Intronic
1148875119 17:50682638-50682660 GGTCAGGGAAGGCTTCCTGGAGG - Intronic
1149561655 17:57611795-57611817 GGCCAGAGGAGGCCTCAACGAGG - Intronic
1149642081 17:58209514-58209536 GGTAAGAGAAGGCCTCTCAGAGG + Intronic
1149792987 17:59495337-59495359 GGTCAGGGAAGGCCTCTCTGAGG - Intergenic
1149795732 17:59517490-59517512 GATCAGAAAAGGTCTCAAGAAGG - Intergenic
1150318596 17:64190713-64190735 GGTCAGGAAAGGCCTCCCGGAGG - Intronic
1151467853 17:74299387-74299409 GGTCAGGGAAGGCCTCCTGGAGG - Intronic
1151846129 17:76656984-76657006 GGTCAGGGAAGGCCTCTCTGAGG + Intergenic
1152315501 17:79578161-79578183 GGTAAGAGAAGCGCTCCAGGTGG - Intergenic
1152621880 17:81368920-81368942 GGTCAAAGAAGGGCTCACTGAGG - Intergenic
1152710289 17:81867881-81867903 GGTCAGGGAAGGCCTGCCGGGGG + Exonic
1152990000 18:354764-354786 GGTCAGTGGAGGCCTGAAGGAGG + Intronic
1153266851 18:3279702-3279724 GGTCAGGAAAGGCCTCTGGGTGG + Intergenic
1153328039 18:3842023-3842045 AGTCAGAGAAGGCTTCCAGGAGG + Intronic
1154336849 18:13472566-13472588 GGACAGAGGAGGCCGCCAGGTGG - Intronic
1154504935 18:15027527-15027549 GGTCAGAGAAGGGATCACGAAGG - Intergenic
1155551874 18:26973381-26973403 GGGATGAGAAGGCATCAAGGAGG + Intronic
1156276839 18:35591989-35592011 TGTCAGAGAAGGATTCCAGGTGG + Intronic
1156534873 18:37853062-37853084 GGGCAGAGGAGGCCTGAAAGAGG - Intergenic
1157446979 18:47753459-47753481 GGTCAGGGTAGGCCTCATGGAGG - Intergenic
1157544038 18:48535442-48535464 GATCAGAGAAGGCTTCTGGGAGG - Intergenic
1157548966 18:48567621-48567643 AGTCAGAGAAGGCTTCCTGGAGG + Intronic
1157638338 18:49184988-49185010 GGTCAGGGAAGGCTTCACTGAGG + Intronic
1157789152 18:50515394-50515416 AGTCAGTCAAGGCCTCAACGTGG + Intergenic
1158224265 18:55184338-55184360 GGTCAGAGAAAGCCTTATTGAGG + Intergenic
1158413577 18:57230193-57230215 GTTCAGAGAAGGGACCAAGGAGG + Intergenic
1158674332 18:59504795-59504817 AGCCAGAGAAGGCATCAAAGAGG - Intronic
1160718449 19:587000-587022 GCTGGGAGAAGGCCTGAAGGAGG - Intergenic
1160798084 19:954889-954911 GATCAGAGCAGGCCCCAGGGAGG + Intronic
1160904882 19:1447288-1447310 GCACAGAGGAGGCATCAAGGGGG + Intronic
1160955077 19:1687524-1687546 GGTCAGAGAGGGCTTCCTGGAGG + Intergenic
1161211927 19:3071094-3071116 GGTTAGAGAAGGCCTCTCAGAGG - Intergenic
1161246776 19:3257136-3257158 GGTCAGGGAAGGCCTCTCTGAGG + Intronic
1161316359 19:3619361-3619383 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
1161368461 19:3894979-3895001 GGTCAGGGAAGGCCTCATTGAGG - Intronic
1162079968 19:8211976-8211998 AGTCAGGGAAGGCCTCCTGGAGG + Intronic
1162340287 19:10087592-10087614 GGTCAGAGAAGGCTTACTGGAGG + Intronic
1162397707 19:10426953-10426975 GGTCAGGGAAGGCCTCTCTGAGG + Intronic
1162554797 19:11380142-11380164 GGTCAGGGAAGGCCTCCAGGAGG - Intronic
1162584930 19:11552788-11552810 GGTCAGAGGAGGCTTCTGGGAGG - Intronic
1162766536 19:12923207-12923229 GGTCAGTGAAGGCATCATGGAGG - Intronic
1164683170 19:30149524-30149546 GGTCAGGGAAGGCTTCCTGGAGG + Intergenic
1164925162 19:32124575-32124597 GGTCAGGGGAGGCCACAGGGCGG + Intergenic
1165334001 19:35156518-35156540 GGTCAGGGAGGGCCTCACTGAGG + Intronic
1165419673 19:35716691-35716713 GGGCCGAGACGGCCTCGAGGAGG - Exonic
1165482648 19:36073833-36073855 GGTCAGGGAAGGCCTCCCTGAGG + Intronic
1166219808 19:41357133-41357155 GGTCAGAGAGGGCTTCCTGGAGG - Intronic
1166720089 19:44991530-44991552 GGTCAGAGAGGACTTCAGGGAGG + Intronic
1166818260 19:45560233-45560255 GGTCAGGGAAGGCTTCCTGGAGG - Intronic
1166976196 19:46606394-46606416 GGTCAGGGAAGGCCTCCCCGAGG - Intronic
1166990624 19:46690510-46690532 GGTCAGGGAAGGCTTCCTGGGGG - Intronic
1166993788 19:46709333-46709355 GGGAAGAGAAGGCCCCATGGAGG + Intronic
1166998326 19:46730369-46730391 AGTCAGAGAAGGCTTCCTGGAGG + Intronic
1167031889 19:46967835-46967857 GATCAGAGAAGGACTCTGGGAGG - Intronic
1167296231 19:48651840-48651862 GGTCAGGGAAGGCTTCCTGGAGG - Intergenic
1167406227 19:49310414-49310436 GGTCAGAGCATGCGTCAGGGTGG - Exonic
1167429976 19:49448576-49448598 GGTCAGGGAAGGCTTCCTGGAGG - Intronic
1167667787 19:50832790-50832812 GGTCAGAGAAGGCCTCAAGGAGG - Intronic
1167692971 19:50998271-50998293 GGTCAGGGAAGGCTTCCAGGAGG - Intronic
1168071073 19:53952137-53952159 GGTCAGGGAAGGCTTCCTGGAGG + Intergenic
1168487637 19:56778049-56778071 AGTCAGAGAAGGCCTCACTGTGG - Intronic
925280834 2:2683329-2683351 GCTCAGAAAGGGCCTCAAGCAGG - Intergenic
926219353 2:10924829-10924851 GGTCAGAGAAGGCTTCCTGGGGG - Intergenic
926260243 2:11253447-11253469 GGTCAGAGAAGACCTCTTTGAGG - Intronic
926580048 2:14625121-14625143 AGTCAGAGAAGGCTGCCAGGAGG + Intergenic
926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG + Intergenic
926756721 2:16242336-16242358 GGTTAAAAAAGGCTTCAAGGAGG + Intergenic
926811202 2:16756744-16756766 GGTCAGAGAATTCCAGAAGGCGG + Intergenic
926861751 2:17317395-17317417 GGTCAGAGACCTCCTCAAGCTGG + Intergenic
927293054 2:21423255-21423277 GGTCAGGAAAGGCTTCTAGGAGG + Intergenic
927787117 2:25981878-25981900 GGCCAGCGAGGCCCTCAAGGTGG - Exonic
927860548 2:26557704-26557726 GGTCAGGGAAGGCTTCCCGGAGG - Intronic
927960445 2:27237828-27237850 GCTCAGAGAAGGTCTCATTGAGG - Exonic
927965643 2:27265975-27265997 GGCCAGAGAAGGCCTCCCCGAGG - Intronic
927970844 2:27305739-27305761 GCTTAGAGGAGGCCTCCAGGTGG - Exonic
928438345 2:31270782-31270804 GGTCAGAGAAAGCCTGTAGCAGG + Intergenic
929076071 2:38079939-38079961 GGTCCTAGAAGGACTCCAGGGGG + Intronic
929189103 2:39123183-39123205 GATCGGAGAAGGCCTCTTGGAGG - Intronic
929560400 2:42952953-42952975 GGTCAGGGAAGGCTTCCTGGAGG - Intergenic
929758044 2:44784589-44784611 GGTCAGAGAAAGCCTCCCTGAGG + Intergenic
929947277 2:46380828-46380850 GCTCAGAGAAGGGCTAAATGGGG - Intronic
930062538 2:47302355-47302377 GGTCAGAGAAGGCTTCCTTGGGG + Intergenic
930254008 2:49068178-49068200 TGTGAGTGAATGCCTCAAGGGGG - Intronic
931656544 2:64514015-64514037 TGTCAGTGAAGGCTTCCAGGAGG + Intergenic
932074541 2:68650800-68650822 AGTCAGAGGAGGCTTCATGGAGG + Intronic
932105139 2:68935399-68935421 GGTCTGGGGTGGCCTCAAGGTGG + Intergenic
932192409 2:69752056-69752078 GGTCACAGAAGGCTTCCTGGAGG + Intronic
932285680 2:70529803-70529825 GGACAGAAGAGGCCTTAAGGAGG + Intronic
932633889 2:73371125-73371147 TATCAGAGAAGGCCTCTAGTAGG + Intergenic
932739403 2:74280296-74280318 GGTCAAGGAAGGCTTCTAGGAGG - Intronic
932913945 2:75834655-75834677 GGTCAGGGACCGACTCAAGGAGG - Intergenic
933690054 2:85172803-85172825 GGTCAGGGGAGGCCTCACTGAGG - Intronic
933835526 2:86242472-86242494 GATCAGAGGAGGCTTCATGGAGG + Intronic
934853708 2:97716526-97716548 GGTCAGGGAAGGCCTCCTGGAGG + Intronic
937073267 2:119082126-119082148 AGTCAGAGTGGGCCTCATGGAGG + Intergenic
938086592 2:128405981-128406003 AGTCAGAGAAGGCTTCCTGGAGG + Intergenic
938504129 2:131857729-131857751 GGTCAGAGAAGGGATCACGAAGG - Intergenic
938608475 2:132921594-132921616 GCTCAGAGAAGGCCTCCTGGAGG + Intronic
938810235 2:134846065-134846087 GATCAGAGAAGGCCTTCTGGAGG + Intronic
938895450 2:135745364-135745386 GGTCAGAGAAGCCCTCTCTGAGG - Intronic
939112982 2:138030121-138030143 GGTCAGGGAAGGCCTCAGAGTGG - Intergenic
939290903 2:140193709-140193731 GGCCAGGGAAGGCCTCTATGGGG - Intergenic
939534506 2:143410757-143410779 GGCCAGAGAAGGCCTCAGAAAGG + Intronic
939983810 2:148811477-148811499 GGTCAGAGAAGGCCTCTTGAAGG - Intergenic
941150412 2:161907632-161907654 GTTCAGAGAAGGCTTCCTGGAGG + Intronic
943814290 2:192231941-192231963 GTTCAGAGAAGGACTGAAGAAGG - Intergenic
944280080 2:197885672-197885694 GGTCAGAGAAGGCCTATCTGAGG - Intronic
944417422 2:199492789-199492811 GGTCAGGGAAGGCCTCTCTGAGG + Intergenic
944457919 2:199914838-199914860 GGTCAGAAAAGGCCTCAGAGAGG - Intronic
944860270 2:203809643-203809665 GGTCAGGGAAGGCCTCTCTGAGG - Intergenic
945124398 2:206492273-206492295 GGTCAGAAAAGGCTTGAAGGGGG + Intronic
945233672 2:207614725-207614747 GGTAAGAGAAGACCTTAAGGTGG + Intronic
946710325 2:222498797-222498819 GGTCAGAGAAGGCCTTTCAGAGG + Intronic
947426238 2:229985495-229985517 GATCAGAGAGGGCAGCAAGGAGG - Intronic
947499685 2:230662935-230662957 AGTCAGAGCAGGCCTCATCGAGG + Intergenic
947665749 2:231904417-231904439 GCTCCTAGAAGGCCTCAAGGTGG - Intergenic
948382242 2:237558926-237558948 GGGAAGAGAAGGGCACAAGGGGG - Intergenic
948902605 2:240964031-240964053 GGTCACAGGTGGCCTCCAGGAGG + Intronic
1168815437 20:733661-733683 GGTCAGGGAAGCCCTCTTGGAGG + Intergenic
1168830281 20:841754-841776 GGTGAGAGGAGGCCTCAGAGGGG + Intronic
1168856815 20:1014419-1014441 GGTCAGGGAAGGCCTCTTTGAGG - Intergenic
1168895370 20:1320204-1320226 GGGCAGAGAAGACATCCAGGGGG - Intronic
1168952752 20:1813736-1813758 GGTCAGGGAAGGCCTCTCTGGGG + Intergenic
1168956800 20:1840240-1840262 GGTCAGAGCAGGGCTCCATGTGG + Intergenic
1168974197 20:1951915-1951937 GGTCAGGGAAGGCTTCTGGGAGG - Intergenic
1169018496 20:2310880-2310902 GGTCAGGGGAGGGCTAAAGGTGG + Intronic
1169226862 20:3862316-3862338 GGTCAGAGGAGGACTCCAGGGGG - Exonic
1169382784 20:5122998-5123020 GGTCAGAGAAGGCCTCTCTGAGG + Intronic
1169989224 20:11482025-11482047 GGTCAGAGAAGGACTTTTGGAGG + Intergenic
1170349386 20:15422278-15422300 TGGCAGTGATGGCCTCAAGGAGG + Intronic
1170474771 20:16703951-16703973 GGTCAGAGAAAGGCTCTCGGAGG + Intergenic
1170560387 20:17552184-17552206 GGTCAGAGAAGACCTCACTGAGG + Intronic
1170926145 20:20726180-20726202 GCTCAGAGAAGGCTTCCTGGTGG + Intergenic
1171473171 20:25388467-25388489 GGTCTAAGAAGGCCTCAGTGAGG + Intronic
1171575503 20:26308910-26308932 TGCCAAAGAAGGCCTCAAAGAGG - Intergenic
1172021810 20:31919955-31919977 GGTCAGAGGAGGGTTCAGGGAGG - Intronic
1172041065 20:32046324-32046346 GGTCAGAGAAGGCTTCTCTGAGG - Intergenic
1172070290 20:32251751-32251773 GGTCAGAGGAGGCTTCACAGAGG + Intergenic
1172120164 20:32593700-32593722 GGTCAGGGCAGGCTTCATGGAGG - Intronic
1172128150 20:32637506-32637528 AGTCAGGGAAGGCCTCATGGAGG - Intergenic
1172306549 20:33884801-33884823 GGTCAGGGAAGGCCTCTTGGAGG - Intergenic
1172572545 20:35981952-35981974 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
1172621580 20:36321147-36321169 GGTCAGGGAAGGCTTCTCGGAGG + Intronic
1172871542 20:38138603-38138625 GGTCAGAGAGGGCTTCCTGGAGG - Intronic
1172880191 20:38194849-38194871 GGTCAGGGAAGGCATCTAGGAGG + Intergenic
1172902469 20:38345029-38345051 GGTCAGGGAAGGCTTCCTGGGGG + Intergenic
1173644906 20:44627153-44627175 GGTCAGGGAAGGCCTCTCTGAGG - Intronic
1173833877 20:46112537-46112559 GGTCAGGGAAGGCCTCTCTGAGG + Intergenic
1173946390 20:46954167-46954189 GATCAGGGAAGGCCTCTCGGAGG - Intronic
1173994133 20:47324795-47324817 GGTCAGAGAAGGCCTCTCTAGGG - Intronic
1174749973 20:53102225-53102247 GTGCAGAGAAGGCCTCAGGTTGG - Intronic
1175012928 20:55758055-55758077 TGTCAGTGAGGGCATCAAGGGGG - Intergenic
1175130850 20:56788546-56788568 GGTCAGGGAAGGCCTCTTTGGGG + Intergenic
1175606385 20:60315317-60315339 GGGCAGAGAAGGCTTCCTGGAGG + Intergenic
1176108224 20:63399396-63399418 GGTCTGAGAAGGGCTAGAGGGGG - Intergenic
1176792922 21:13341607-13341629 GGTCAGAGAAGGGATCATGAAGG + Intergenic
1177992309 21:28052437-28052459 GGTCAGAGAAGGGATCACGAAGG + Intergenic
1179599607 21:42467476-42467498 GGACAGAAAAGGCCACAAGGAGG + Intergenic
1179634070 21:42696328-42696350 GCGCAGAGAAGGGCTCCAGGAGG - Intronic
1179727684 21:43349438-43349460 GGTCACACAGGGCCTCCAGGGGG - Intergenic
1179774015 21:43648113-43648135 GGACAGAGAAGGTGGCAAGGTGG - Intronic
1180692078 22:17725465-17725487 GATCACAGAAAGCCTCACGGAGG - Intronic
1180714921 22:17865299-17865321 GGCAACAGAAGCCCTCAAGGGGG + Intronic
1180953830 22:19732544-19732566 GGGCAGAGAAGACCCCCAGGAGG - Intergenic
1180971574 22:19818903-19818925 GGACAGGGAAGGCCTGCAGGGGG - Intronic
1181601353 22:23953655-23953677 GCTCAGGGAAGGCTTCCAGGAGG - Intergenic
1181607153 22:23987682-23987704 GCTCAGGGAAGGCTTCCAGGAGG + Intergenic
1181774539 22:25149902-25149924 GGTCAGGGAAGGCTTCCTGGAGG - Intronic
1181830289 22:25555128-25555150 GGTCAGAGACAGCCTCCAGGTGG - Intergenic
1181869284 22:25885393-25885415 GGTCAGGGAGGGCTTCACGGGGG + Intronic
1181970187 22:26684025-26684047 GGTCAGAGAGGGCCTCTCAGAGG + Intergenic
1181989809 22:26828925-26828947 GGTCAGGGAAGGCTTCCTGGAGG + Intergenic
1182012408 22:27011848-27011870 GATCAGAGAAGGCCTCCCGGGGG - Intergenic
1182096761 22:27630864-27630886 GGCCTGAGCAGGCCTCCAGGTGG - Intergenic
1182312757 22:29420939-29420961 GCTTAGAGAAGGGCTCAGGGGGG - Intronic
1182576708 22:31277873-31277895 CGTCAGAGCAGGCCTCACTGAGG + Intronic
1182670337 22:31990474-31990496 AGTCAGAGAAGGTTTCATGGAGG + Intergenic
1183007127 22:34912831-34912853 AGCCAGAAAAGGCCTCAGGGAGG + Intergenic
1183322437 22:37173200-37173222 GGTCAGGGAAGGCCTCTCTGAGG - Intronic
1183514005 22:38252653-38252675 GGTCAGAGAAGGCTTCCATGTGG + Intronic
1183673144 22:39284568-39284590 GGTCAGGGAAGGCTTCCTGGAGG + Intergenic
1183676458 22:39301558-39301580 GGTCAGGGAAGGCTTCCAGGAGG + Intergenic
1183734395 22:39635852-39635874 GGCGAGGGAAGGCCTCTAGGAGG - Intronic
1183840576 22:40497196-40497218 AGTTAGAGAAGGCCTCCAGGAGG + Intronic
1184011873 22:41754945-41754967 GGTCAGGGAAGGCCTCCATGTGG + Intronic
1184015169 22:41780527-41780549 GGTTAAGGAAGGCTTCAAGGGGG + Intronic
1184059975 22:42075461-42075483 GGTCAGGGAAGGCTTCCCGGTGG + Intronic
1184205807 22:43001876-43001898 GGACAGAGAGGGGCTCCAGGTGG - Intronic
1185395895 22:50587946-50587968 TGTCAGAGAAGGCCTGGAGCAGG - Intronic
949958659 3:9292406-9292428 AGGCAGAGAAGGCTTCATGGAGG - Intronic
950019368 3:9776287-9776309 GGTCAGGAAAGGCTTCAGGGAGG - Intronic
950107498 3:10397542-10397564 GGTCAGGGAAGCCTTCATGGAGG + Intronic
950132281 3:10555448-10555470 GGTCAGGGAAGGCTTCCCGGAGG - Intronic
950330863 3:12155104-12155126 GGTCAGAGATGGCTTTGAGGTGG - Intronic
950519209 3:13486493-13486515 GGTCAGGGAGGGCCTCACAGAGG + Intronic
950566215 3:13771183-13771205 GGTCGGAGAAGGCCTCTCGGAGG - Intergenic
951688572 3:25371905-25371927 GGTCAGGGAAGGCCCCACTGAGG + Intronic
953604228 3:44399536-44399558 GGAAAGAGAAGGGCTGAAGGGGG - Intronic
954068515 3:48125961-48125983 AGTCAGGGAAGGCCTCCTGGGGG + Intergenic
954155709 3:48683902-48683924 GGTCAGCAAAGCCCTCCAGGTGG + Intronic
954263340 3:49455634-49455656 GGTCTGAGAAGGCCACATGGAGG - Intergenic
954534445 3:51348611-51348633 AGTCAGGGAAGGCCTCTTGGAGG + Intronic
954795375 3:53158795-53158817 GGGCAGAGAAGGGATGAAGGTGG - Intronic
954871959 3:53774215-53774237 GGTCAGGGAAGGCCTCTAGGGGG - Intronic
954930911 3:54280565-54280587 AGTCAGGGCAGGCCTCAGGGAGG + Intronic
955143506 3:56292863-56292885 TGTCAGGGAAGGCCTCTTGGAGG - Intronic
955403415 3:58609781-58609803 GGTCACAGATGGCCTCATGGGGG - Intronic
955413142 3:58668750-58668772 GGTCAGGGAAGGCCTCTCTGAGG + Intergenic
956337331 3:68178523-68178545 GTTCAGGGAAGGCATCCAGGAGG + Intronic
956693809 3:71901646-71901668 GGTGAGAGCAGGACTGAAGGAGG - Intergenic
958212709 3:90509489-90509511 TACCAGAGAAGGCCTCAAAGAGG + Intergenic
958776742 3:98493471-98493493 GGTCAGCAAAGGCTTCATGGAGG - Intergenic
959388767 3:105746625-105746647 GGTCAGAGAAGGCTTCATTGAGG - Intronic
959513242 3:107237295-107237317 GATCAGGGAAGGCCTCACGGAGG - Intergenic
959616117 3:108349135-108349157 GATCAGAGAAGAACTGAAGGAGG + Intronic
959971738 3:112417184-112417206 GGTCAGGGAAGGCCTCTGTGGGG - Intergenic
960722658 3:120640049-120640071 GGTCAAGGAAGGCTTCAAAGAGG + Intronic
960942597 3:122944344-122944366 AGTCAGAGAAGGCTTCTTGGAGG - Intronic
961099232 3:124184605-124184627 GGTCAGGAAAGGCTTCAAAGGGG - Intronic
961260863 3:125600798-125600820 GGTCAGGGAAGGTCTCTAGGAGG - Intergenic
961370347 3:126424809-126424831 GGGTAGAGAAGGCTTCCAGGAGG + Intronic
961519471 3:127458535-127458557 GGTCAGAGAAGGCTTCCCGGAGG - Intergenic
961824309 3:129590872-129590894 GCTCAGAGCAGGACTCAGGGAGG + Intronic
961830755 3:129621895-129621917 GGTCAGAGAGGGCTTCCTGGAGG + Intergenic
961849766 3:129804431-129804453 GGTCAGGGGAGGCCTAATGGAGG - Intronic
962071029 3:132034240-132034262 GGTCAGGGAAGTCCCGAAGGCGG - Intronic
962103036 3:132362642-132362664 GGTCAGAGAAGGCTTCTTGGAGG + Intronic
962233835 3:133691553-133691575 GGTCAGGGAATGCCTCACTGAGG + Intergenic
962854601 3:139332438-139332460 GGTCAGGGAAGGCATCCAGGAGG + Intronic
962942386 3:140137398-140137420 GGTCCAAGAAGGCTTCATGGAGG - Intronic
964348070 3:155774921-155774943 AGTCAGAGAAGGCCTCATTGAGG - Intronic
964529354 3:157650431-157650453 GGTCAGGGAAGGCCTCAGTGAGG + Intronic
964597364 3:158450004-158450026 GGTCAGGGAAGACATCTAGGAGG - Intronic
964717571 3:159738837-159738859 GGTCAGGGAAGGCCTGACTGAGG + Intronic
965432366 3:168605422-168605444 GGTGAGAGCAGCCCTGAAGGTGG + Intergenic
965922268 3:173931425-173931447 GGTCATGGAAGGCTTCAATGAGG + Intronic
966256736 3:177925533-177925555 GGGCAGAGAAGGCCTCAGGGTGG + Intergenic
966997412 3:185296533-185296555 GGTCAAAGAGGGCCTCACTGAGG - Intronic
967022652 3:185536008-185536030 GGTCAGAGAAGGCTTCATTAAGG - Intronic
967204908 3:187110608-187110630 GGTCAAAGAAGGCTTCCTGGAGG + Intergenic
968593484 4:1471216-1471238 GGCCTGAGAAGGCCCCAAGGAGG + Intergenic
968934632 4:3603599-3603621 AGTCAGGGAAGGCTTCCAGGAGG + Intergenic
969046143 4:4338241-4338263 GATCTGAGAAGGCTTCATGGAGG + Intergenic
969471075 4:7389659-7389681 GGTCAGGGAAGGCTTCTAGGAGG + Intronic
969528392 4:7715820-7715842 GGTCAGGGAAGGCTTCCTGGAGG - Intronic
969531310 4:7732647-7732669 GGTCAGGGAAGGCCTCCTGGAGG - Intronic
970260821 4:14222703-14222725 GTTCAGAGAAGGCCTCTTAGAGG + Intergenic
971029638 4:22622223-22622245 GGGATGAGAAGGCATCAAGGAGG + Intergenic
971274569 4:25183611-25183633 GGGCAGAGAAAGCCTCACAGAGG + Intronic
971408009 4:26340212-26340234 GGTCAAGGAAGGCCTCACAGAGG + Intronic
972090186 4:35271568-35271590 GGTCAGGGAAGGCCTCTCTGAGG + Intergenic
972205058 4:36761822-36761844 GAGAAGAGAAGGACTCAAGGTGG + Intergenic
972252807 4:37322334-37322356 GCTCAGAGAAGGCCTCTCTGAGG + Intronic
972316998 4:37935988-37936010 GGCCAGAGAAGGCCTCCTGGGGG - Intronic
972681130 4:41307836-41307858 GGTGAGAGAAGGCTCCAAGCAGG + Intergenic
975358220 4:73433293-73433315 GGTCAGATAAGGCTTCCTGGAGG - Intronic
975435437 4:74345650-74345672 CTTCTGAGAAGGCCTCAGGGAGG + Intergenic
975913528 4:79297336-79297358 GGACAGAGAGGGCCTCAGCGAGG + Intronic
976005944 4:80431000-80431022 GGTCAGAGGAGGTCTCACGAAGG - Intronic
976317460 4:83673778-83673800 GGTCAGAGGAGGCTTCAAAGAGG - Intergenic
976588537 4:86825893-86825915 GGTGAGAGAAGGCTTCACAGAGG + Intronic
976705317 4:88013748-88013770 GGTCAGAGAAGGTTTCCAGAGGG + Intronic
976803627 4:89021232-89021254 TATCAGAGAAGGCCTCCTGGAGG + Intronic
978220282 4:106264277-106264299 GGTCAGGGAAGTCCTCACTGAGG + Intronic
978290541 4:107133745-107133767 GATCTGAGAAAGACTCAAGGAGG - Intronic
979694559 4:123597911-123597933 GGTCAGAGAAGGCCTCTCAAAGG - Intergenic
979977075 4:127210099-127210121 GGTCATAGAAGTCCTGGAGGAGG - Intergenic
981005002 4:139865772-139865794 GGTCAGAGGAGGACCCAAGCAGG - Intronic
981540671 4:145843526-145843548 GGTAAGAGGAGGCCCCAAGTTGG - Intronic
981695613 4:147556119-147556141 GGTCAGAGAAAGCCTCCCTGAGG + Intergenic
981713143 4:147728529-147728551 GGTCAAGGAAGGCCTCATTGAGG - Intergenic
981896216 4:149803433-149803455 GGTCAAAGAAAGGCTCAATGAGG - Intergenic
982025836 4:151253363-151253385 GGTCAGACAAGGCATCACTGAGG - Intronic
982771811 4:159403373-159403395 GTTCAGACAAGGCCTAGAGGTGG + Intergenic
983676876 4:170305166-170305188 GGTCAGGGAAGGCCTCTCAGTGG - Intergenic
983784607 4:171715768-171715790 GCTCAGAGGAGGCCTGCAGGGGG - Intergenic
983984374 4:174040527-174040549 AGTCAGAGAAGGCTCCTAGGAGG + Intergenic
985432939 4:189898787-189898809 GCTGACAGAAGGCATCAAGGAGG + Intergenic
986229756 5:5852564-5852586 GGCCAGGGAAGGCCTCAGGGAGG + Intergenic
988093176 5:26568925-26568947 GCTCAGAGAAGACCTACAGGGGG + Intergenic
988493041 5:31721120-31721142 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
989604020 5:43226904-43226926 AGTCAAAGAAGGCCTCTAGAAGG + Intronic
989781142 5:45265945-45265967 GGTCAGAGAAGGTTTCTAGAGGG + Intronic
990598434 5:57333648-57333670 GGTCAGGGGAGGCCTCTAGGAGG + Intergenic
991200666 5:63987820-63987842 GGCCAAGGAAGGCCTCCAGGAGG - Intergenic
991478288 5:67047470-67047492 GGTCAGGAAAGGCCTCACTGGGG - Intronic
991994151 5:72370715-72370737 GGTCAGGGAAGGCCTCTCTGAGG - Intergenic
992902754 5:81315363-81315385 GGTCATAGAAAGACTCAAGCTGG - Intergenic
992906342 5:81349556-81349578 GGTCAGAGAAGGCTCCACTGAGG - Intronic
993530194 5:89014858-89014880 GGTCAGGGAAGCCTTCATGGAGG + Intergenic
993846210 5:92946921-92946943 GATCAGAGAAGGCTTAAGGGAGG + Intergenic
993846446 5:92950414-92950436 GGTCAAAGAAGGAATTAAGGAGG - Intergenic
994078634 5:95681453-95681475 GGTCAAAGAAGGCTTCATGGAGG - Intronic
994991245 5:106999730-106999752 GGTCAGAGACCCACTCAAGGAGG + Intergenic
995768203 5:115641289-115641311 AGTCAGAGAAGGCTTCCAGGAGG + Intergenic
997672423 5:135686477-135686499 AGTCAGAGAAGGCTTCACTGAGG - Intergenic
997870818 5:137503838-137503860 GGTCAGGGAAGGCTTCAATGAGG - Intronic
997879835 5:137579719-137579741 GGTCAGAGAAGGCCTCCCCAGGG + Intronic
998065324 5:139153280-139153302 GGTTGGGGAAGGCCTCAAAGCGG - Intronic
998157314 5:139794529-139794551 GGTCAGAGAAGACTTCATGAAGG + Intergenic
998350483 5:141497221-141497243 GATCAGAGAAGGCTTCTAGGAGG + Intronic
998448674 5:142217882-142217904 AGTCAGGGTAGGCCTCATGGAGG + Intergenic
998476857 5:142429242-142429264 GGTCAGGGAAGGCTTCCTGGAGG + Intergenic
998508999 5:142695906-142695928 GGCCAGATAAGGCCTCAGAGGGG + Intronic
998882291 5:146656211-146656233 GGTCATAGAAGGCCTCTCTGAGG + Intronic
998920370 5:147061314-147061336 GGTCAGGGAAGGCTTCTTGGAGG + Intronic
999255547 5:150208248-150208270 GGTCAGAGAAGACCTCTCTGAGG + Intronic
999361900 5:150992569-150992591 GGTGGGAGAAGGACTGAAGGAGG + Intergenic
999563049 5:152825985-152826007 GGGCAGAGAAAGCCTCAACAAGG - Intergenic
1000245960 5:159448779-159448801 GGTCAGGGATGGCTTCATGGAGG + Intergenic
1001288978 5:170443089-170443111 GGTCAGAGAGGGTCTAAAGCAGG + Intronic
1001370560 5:171196214-171196236 GGTCAGGGAAGGCCTCTCTGAGG + Intronic
1001404572 5:171466866-171466888 AGTCAGAGAAGGCTTCCTGGAGG + Intergenic
1001707155 5:173749875-173749897 GGTCAGTGAAGGCCTCTTTGAGG + Intergenic
1002046397 5:176543757-176543779 GGTCAGAGAATGGCCCAAAGCGG - Intronic
1002197749 5:177510293-177510315 GGTCAAGGGAGGCCTCCAGGAGG - Intronic
1002664454 5:180811955-180811977 GGTCAGGAAAGGCCTCACTGAGG - Intronic
1003572099 6:7262424-7262446 AGTCACAGGGGGCCTCAAGGAGG - Intergenic
1003735131 6:8869513-8869535 GATCAGAGAAGACCCCACGGGGG + Intergenic
1004167175 6:13267004-13267026 GGTCAGGAAAGGCTTCCAGGAGG - Exonic
1005282134 6:24285346-24285368 TGTCAGGGGAGGCCTCATGGAGG - Intronic
1005804489 6:29461799-29461821 GTTCAGAGAAGCCCAGAAGGAGG - Exonic
1005819719 6:29587974-29587996 GTTCAGAGAAGCCCAGAAGGAGG - Exonic
1005891157 6:30139684-30139706 GGTCAGTGAGGGCCTCATAGAGG + Intronic
1006073651 6:31515585-31515607 GGTCAGGGTAGGCCTCTTGGAGG + Intergenic
1006103069 6:31698740-31698762 GGTCAGGGAAGGCCTCTCTGAGG + Intronic
1006390646 6:33756277-33756299 GGTCAGGGAAGGCCTGGCGGAGG + Intergenic
1006397880 6:33798818-33798840 GGTCAGGGAAGGCCTCTTGGAGG - Intronic
1006417861 6:33915474-33915496 GGTCAGAGAAGACCTGGTGGAGG + Intergenic
1006797383 6:36740425-36740447 GGTCAGAGAGGGCCTCTCAGAGG - Intergenic
1006986409 6:38178566-38178588 GGTCAGGGAAGGCTTCCTGGGGG + Intronic
1007120831 6:39379581-39379603 GGTCAGGGAAGGCTTCACAGAGG + Intronic
1007369771 6:41418833-41418855 GGCCAGTGAAGGCTTTAAGGAGG - Intergenic
1007915891 6:45561382-45561404 GGGCAGAGGGGGCCCCAAGGAGG + Intronic
1009094657 6:58962821-58962843 TTCCAAAGAAGGCCTCAAGGCGG - Intergenic
1009192835 6:60650258-60650280 TATCAGGGAAGGCCCCAAGGAGG - Intergenic
1010007848 6:71015073-71015095 GGGTAGGGAAGGCTTCAAGGAGG + Intergenic
1011553703 6:88552669-88552691 GGTCAGAGAAGACGTCAAGCAGG - Intergenic
1011652670 6:89521306-89521328 GGTCAGGGAAGGCCTCTCTGGGG + Intronic
1011749683 6:90442680-90442702 GGTCAGAGAAGGCTTCCCAGAGG + Intergenic
1012180389 6:96145607-96145629 GGTCAAAGAAGGCCTCATTGTGG + Intronic
1012445798 6:99306066-99306088 GGTCAGGGAAGGCCTCTCTGTGG + Intronic
1013308751 6:108873777-108873799 GGTCAGAGAAAGCTTCACAGAGG - Intronic
1013506920 6:110809929-110809951 ATTAAGAGAAGGCTTCAAGGAGG + Intronic
1014036286 6:116770084-116770106 GGACAGGAAAGGCCTCTAGGAGG - Intergenic
1015590613 6:134819353-134819375 GGTCAGAGAAGGGCTGGTGGAGG - Intergenic
1016380747 6:143476103-143476125 GGTCAGAAAAGGCCTCTTTGAGG + Intronic
1016826796 6:148395851-148395873 GGTCAGGAAAGTACTCAAGGTGG + Intronic
1017442699 6:154478385-154478407 GTCCAGAGAAGGCCTCAAAAAGG - Intronic
1017487517 6:154916937-154916959 GGTCAGGGAAGACCTCACTGGGG + Intronic
1017628354 6:156370824-156370846 GGTTAGAGAAGTCTTCATGGAGG - Intergenic
1017630664 6:156393362-156393384 TGTCAGAGAAGGCCTCTCTGGGG - Intergenic
1018292414 6:162306223-162306245 GGTCAGAGATGGCCTGACTGAGG + Intronic
1018978234 6:168581919-168581941 GGTCAGAGAAGGCCTCTGCACGG - Intronic
1019200132 6:170307134-170307156 GGTCAGAGGTGACCTCAAGATGG - Intronic
1019719516 7:2559629-2559651 GGTCAGAGGAGGCTTCCTGGAGG + Intronic
1020405139 7:7824511-7824533 GGTCAGAGAAAGCCTCACACAGG - Intronic
1021964619 7:25905457-25905479 GGGCAGAGCAGGCCTCACTGAGG + Intergenic
1022242247 7:28523790-28523812 GATCAGAGAAGGCTTCATGGAGG - Intronic
1022473287 7:30694645-30694667 GGTCAGAGAAGGACTCAGCTGGG + Intronic
1022606026 7:31815087-31815109 TGTCAGAGTAGGCTTCAAGAGGG - Intronic
1022664240 7:32395303-32395325 GGTCAGGGAAGGCTTCCTGGAGG + Intergenic
1022940434 7:35231758-35231780 GGTAAGGGAAGGCCTCAGAGAGG + Intronic
1023056718 7:36296484-36296506 GGTCAGGGAAGGCTTCCCGGAGG - Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024516606 7:50264752-50264774 GGACAGGGAAGGCCTCAGGAGGG + Intergenic
1025606655 7:63044479-63044501 GGTCAGGGAAGGCTTCCTGGGGG - Intergenic
1026177941 7:68014190-68014212 GGTCACTGAAGGCCTCCAAGGGG + Intergenic
1026929328 7:74215243-74215265 GGTCAGGGAAGGCTTCTTGGAGG - Intronic
1027222027 7:76220308-76220330 AGTCAGGGAAGGCTTCACGGAGG + Intronic
1027878495 7:83801844-83801866 GGCCAGAGAAGCCATGAAGGGGG + Intergenic
1028144599 7:87307542-87307564 GATCAGAGCAGACCTGAAGGAGG + Intergenic
1029140736 7:98407985-98408007 GGTCAGGAAAGGCCTCTATGAGG - Intergenic
1029599653 7:101556212-101556234 GTTCAGAGAAGGCTTCACAGAGG - Intronic
1029610645 7:101624896-101624918 GGTCAGGGAAGGCTTCTCGGAGG - Intronic
1030496962 7:110312294-110312316 GATCAGGGAAGGCCTCACTGAGG - Intergenic
1031155896 7:118111724-118111746 GGTCAGGGAAAGTCTCAATGAGG - Intergenic
1031218542 7:118930660-118930682 AGTCAGAGATGGCCTCACAGTGG - Intergenic
1031859811 7:126965738-126965760 GGTCAGGGAAGGCTTCATAGAGG - Intronic
1032068368 7:128789723-128789745 AGTCAGAGAAGGCCACCTGGAGG + Intergenic
1032447767 7:131999360-131999382 GATCAGGGAAGGCCTCCTGGAGG + Intergenic
1032629152 7:133628335-133628357 TGTCAGAGAAGGCTTGAAGTGGG - Intronic
1032948293 7:136877087-136877109 GAACATAGAAGGCATCAAGGAGG + Intronic
1033266971 7:139895103-139895125 AGGCAGAGAAGGCTTCTAGGAGG + Intronic
1033347168 7:140534575-140534597 GGCCCGAGGAGCCCTCAAGGAGG + Intronic
1033786194 7:144733605-144733627 GATCAGGGAAGGCTTCCAGGAGG - Intronic
1034429014 7:151031368-151031390 GGTGGGAGAAGGCCTCATGTAGG + Intronic
1034432827 7:151049595-151049617 AGACAGAGAAAGCCCCAAGGAGG - Intronic
1034441681 7:151088854-151088876 GGTCAGGGGAGGGCTCTAGGAGG - Intronic
1036595860 8:10211449-10211471 GGTAGGAGAAGCCCCCAAGGAGG - Intronic
1037826258 8:22162411-22162433 GATCAGAGAAGGCTTCTTGGAGG - Intronic
1037881019 8:22573565-22573587 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
1037988142 8:23302380-23302402 GGTCAGGGAGGGCTTCATGGAGG - Intronic
1039042519 8:33421912-33421934 GGTGATGGAAGGCATCAAGGTGG - Intronic
1039405511 8:37309132-37309154 AGTCAGAGAAGACCTCTTGGAGG - Intergenic
1039555296 8:38470867-38470889 GGGCAGGGAAGGCCTCTTGGGGG - Intergenic
1039567963 8:38564707-38564729 GGTCAGGGAAGGCCTCATGAGGG - Intergenic
1039901244 8:41753981-41754003 GGTCAGAGAAGGCTACCATGAGG - Intronic
1040661187 8:49577715-49577737 GGTCAGAGAAGTATTCAAGCAGG - Intergenic
1041023545 8:53661172-53661194 GGTCAGAGAAGGCCTCTGGGAGG + Intergenic
1041381967 8:57260471-57260493 GGTCCCAGATGGCCTGAAGGAGG - Intergenic
1041698227 8:60760089-60760111 GGTCAGACAAGGCTTCACAGAGG + Intronic
1042100462 8:65270843-65270865 GGTCAGTAGAGACCTCAAGGGGG + Intergenic
1042106897 8:65337736-65337758 GGTCAGAGAAGGCTTCTGTGAGG + Intergenic
1042326514 8:67534338-67534360 GCTCAGAGAAGGGATCAAGGTGG + Intronic
1042477560 8:69266272-69266294 GGTGAGAGAAGGCCTGAGGAGGG + Intergenic
1042482174 8:69316477-69316499 GGTCATAAAAGGCCTCCTGGAGG + Intergenic
1042997140 8:74713393-74713415 AGTCAGTGAAGGCTTCAAGTAGG - Intronic
1043277746 8:78420964-78420986 GCTCAGGGAAGGCCTCCAAGAGG + Intergenic
1043321315 8:78990057-78990079 GGACAGAGAAGGCTTCCAAGAGG - Intergenic
1043415102 8:80039815-80039837 GGTCAGAGAAGACCTCTTAGAGG - Intronic
1044762472 8:95536058-95536080 GGTCAGAGAAGGCATCACCGAGG - Intergenic
1044818420 8:96136930-96136952 GTTCAGAGAATGCCTCAAAGGGG + Intergenic
1044869689 8:96606808-96606830 GGTCAGAGAAGGCTTCATTAAGG + Intronic
1045393085 8:101734304-101734326 GGTCAGAGAAGGCCTCCCCAAGG - Intronic
1045941379 8:107742835-107742857 TGAAAGAGAAGACCTCAAGGAGG - Intergenic
1046525385 8:115376249-115376271 AGTCAGAAAAGTCCTCCAGGAGG + Intergenic
1046809872 8:118521408-118521430 TGTCAGAGCTGGCCTGAAGGAGG + Intronic
1047167659 8:122458265-122458287 GGTCAGAGAAAACCTCTATGAGG - Intergenic
1047502967 8:125456326-125456348 TATCAGGGAAGGCTTCAAGGTGG - Intergenic
1047913395 8:129555521-129555543 GGTCAGGGAAGGCCTCACTGAGG - Intergenic
1047994994 8:130326122-130326144 AATCAGAGAAGGCTTTAAGGAGG + Intronic
1048419015 8:134258728-134258750 GGTCAGAGAAGGTCTCTCTGTGG - Intergenic
1048444367 8:134482153-134482175 GGTCAGAGAAGAAGTCAAGGTGG - Intronic
1048456615 8:134584250-134584272 GGTCAGAGAAAGCTGCAGGGTGG - Intronic
1048498984 8:134958812-134958834 GATCAGAGAAGGCCTCACAGAGG + Intergenic
1048883991 8:138893907-138893929 GGTCAGGGAAGGCTTCCTGGAGG + Intronic
1048983156 8:139714162-139714184 GGTCAGAGGAGGCCCCAGAGAGG + Intergenic
1049461431 8:142730549-142730571 GGGCAGTGAAGGCCCCAAGAAGG - Intronic
1049724041 8:144137371-144137393 GGTCAGAGAAGGGCTGAATGGGG - Intergenic
1050564898 9:6871982-6872004 GGTCAAAGAAGGCTTCAAAGTGG + Intronic
1052718000 9:32141337-32141359 GGTCAATTATGGCCTCAAGGAGG + Intergenic
1052981443 9:34452806-34452828 GGTCAGGGAAGGCTTCATAGAGG - Intronic
1053005704 9:34602956-34602978 CGTCACTGAAGGCTTCAAGGTGG - Intergenic
1053005971 9:34604873-34604895 GGCCAGAGTAGGCCTCATGAAGG + Intergenic
1053020146 9:34688994-34689016 GGTCAGGGAAGGCTTCCTGGAGG + Intergenic
1053427363 9:38019305-38019327 GGTCAGAGCAGGTCTCCAGGAGG - Intronic
1054455534 9:65428379-65428401 AGTCAGGGAAGGCTTCCAGGAGG - Intergenic
1055574067 9:77645558-77645580 GGTCAGACAGTGCCTCAAGGTGG + Intronic
1057091002 9:92258116-92258138 GGTCAGAGAAGGCCCCTCAGTGG - Intronic
1057239921 9:93399428-93399450 GGTCAGGGAGGGCCTCCTGGAGG - Intergenic
1057708623 9:97417023-97417045 GGCCAGAGAAGGCCTTACTGTGG + Intronic
1057802724 9:98199812-98199834 GGTCAGGGAAGGCTTCTTGGAGG + Intronic
1057809938 9:98250104-98250126 AGTCTGAGAAGGCTTCCAGGAGG + Intronic
1057941959 9:99292864-99292886 GGTCTCAGATGGCCTCAGGGTGG + Intergenic
1059446525 9:114341703-114341725 GGGCAGAGAAGGCCACCACGAGG - Exonic
1059566309 9:115385862-115385884 GGCCAGAGCGGGCCTGAAGGTGG + Intronic
1059921756 9:119167818-119167840 GGTCAAAGAAGGTGTCGAGGCGG + Exonic
1059980988 9:119771795-119771817 GGTCAGAGAAGGATTTATGGAGG - Intergenic
1060186354 9:121566405-121566427 GGTCGGGGAAGGCCTCCTGGAGG - Intergenic
1060274921 9:122175171-122175193 AGTCAGAGAAGGTTTCAAGGAGG + Intronic
1060391638 9:123282597-123282619 GGTCAGAGAAGGCTCCACAGAGG - Intergenic
1060526309 9:124323219-124323241 AGTCAGAGAAGGCTTCCTGGAGG + Intronic
1060802710 9:126554686-126554708 GGTCAGAGAAAGCCACATAGTGG - Intergenic
1060823093 9:126672667-126672689 GGTCTGAGAAGGCCTGAATGGGG - Intronic
1061668125 9:132172246-132172268 AGTCAGAGAAGGCCTCCTGGAGG - Intronic
1061708127 9:132468557-132468579 GGTCAGGGAAGGCTTCCTGGAGG - Intronic
1061881329 9:133570690-133570712 GATCAGAGAAGGCTTCCTGGAGG - Intronic
1062060484 9:134492851-134492873 GGTCAGAGAGGGCTTCCTGGAGG + Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062543051 9:137049977-137049999 AGGCAGAGAAGGCCTGTAGGGGG + Exonic
1062693773 9:137860667-137860689 TGTTAGAGAAGGTCTCAAGTAGG + Intronic
1203340508 Un_KI270311v1:355-377 TTCCAAAGAAGGCCTCAAGGAGG - Intergenic
1187080053 X:15976554-15976576 AGGCAGAGAAGGCCTCACAGAGG - Intergenic
1187215899 X:17276016-17276038 GGTCAGAGAAGGCTTCCTAGTGG - Intergenic
1187243232 X:17531833-17531855 GGTCAGAGAAAGCCTCCCTGGGG - Intronic
1187300933 X:18049166-18049188 AGTCAAAGAAGGCCTCCATGTGG + Intergenic
1188877331 X:35445925-35445947 AGAAAGAAAAGGCCTCAAGGAGG - Intergenic
1189120127 X:38385465-38385487 GGTCAGGGAAGGCCTCTCTGAGG + Intronic
1189792705 X:44619040-44619062 CTTCAGAGAAGGCCTCAAGGGGG - Intergenic
1189965915 X:46373084-46373106 GGTCAAAGAAGGGGTCAAAGAGG - Intergenic
1190286367 X:48964055-48964077 GGTCAGAGAAGGCTTTACTGAGG - Intronic
1190791217 X:53702097-53702119 GGTCAGAGAATACCTCCTGGTGG + Intergenic
1190890061 X:54560042-54560064 GATCAGAGAAGGCCTCCTGGAGG + Intronic
1191027128 X:55925687-55925709 GGTTGGAAAAGACCTCAAGGAGG + Intergenic
1191119256 X:56886472-56886494 TGTCAGAGAAGCCCTTTAGGAGG + Intergenic
1191776911 X:64824254-64824276 GGTCAGAGGAGGCCTAGTGGAGG + Intergenic
1192151580 X:68716044-68716066 AGTCAGAGAAGGCTTCCTGGAGG - Intronic
1192167449 X:68834781-68834803 GGTCAGAGAATGACCAAAGGGGG - Intronic
1192268765 X:69558848-69558870 AGTCAGAGAAGGCCGCACAGAGG + Intergenic
1192312303 X:70027191-70027213 GGTCAGAGAAGGTTTCAAAAAGG - Intronic
1192552266 X:72063954-72063976 GCTCAGAGAAAGCTTCATGGGGG + Intergenic
1192890297 X:75383550-75383572 GGTCAGAAAAGGCTTCACAGAGG - Intronic
1195307910 X:103603789-103603811 AGACAGAGAAAGCTTCAAGGAGG - Intergenic
1195655079 X:107325226-107325248 GCTCAGAGAAGACCTGCAGGGGG - Intergenic
1195679599 X:107534447-107534469 AATCAGGGAAGGCTTCAAGGAGG + Intronic
1195745314 X:108111608-108111630 AGTCAGAGAAGGCTTCATGGAGG - Intronic
1195910214 X:109881886-109881908 GGTCAGGGAAGGCCTCTCAGAGG - Intergenic
1196228551 X:113194172-113194194 GGTCAGGAAAGGCTTCAAAGAGG + Intergenic
1196307774 X:114124812-114124834 GGTCAGAGCAGAACTGAAGGAGG - Intergenic
1196745443 X:119067795-119067817 GGTCAGAGAAGGCCTCTTTGAGG + Intergenic
1196779317 X:119368585-119368607 GGTCAAAGAAGGCCTCTTTGAGG + Intergenic
1196999490 X:121422920-121422942 GGTCAGAGAAGACTTCCTGGAGG - Intergenic
1197292477 X:124675834-124675856 GGTCAGAGAAGGCCTCTTGGAGG + Intronic
1197706489 X:129638193-129638215 GGTCAGAGAAAGCTTCCTGGAGG - Intergenic
1197823102 X:130561426-130561448 GGACAGAGAAGGCATCCTGGAGG + Intergenic
1197969245 X:132097619-132097641 GGACACAGTAGGCCTCAAAGGGG - Intronic
1198542250 X:137652352-137652374 GGTCAGGGAAGGCCTCTCTGAGG + Intergenic
1198838908 X:140835189-140835211 GGGCAGAGAAGGCTTCACTGAGG - Intergenic
1199637982 X:149831631-149831653 GGGCAGTGAAGGCCACAAGAAGG + Intergenic
1199719830 X:150535101-150535123 AGTCAGGAAAGGCCTCAACGAGG - Intergenic
1199991165 X:152988446-152988468 GGTCAGAGAAGAGCCCCAGGAGG - Intergenic
1201960628 Y:19677337-19677359 CTTCAGAGAAGTCCTCCAGGTGG - Intergenic
1202197190 Y:22307853-22307875 AGTCAGTGGAAGCCTCAAGGAGG - Intergenic