ID: 1167667795

View in Genome Browser
Species Human (GRCh38)
Location 19:50832821-50832843
Sequence GGGGAGGCAGACACCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167667795_1167667802 1 Left 1167667795 19:50832821-50832843 CCCTCAGTGGTGTCTGCCTCCCC No data
Right 1167667802 19:50832845-50832867 ACGAGACTGGCAGCTCCCCGAGG No data
1167667795_1167667807 23 Left 1167667795 19:50832821-50832843 CCCTCAGTGGTGTCTGCCTCCCC No data
Right 1167667807 19:50832867-50832889 GAGCTGGTCTGACTCCACTCTGG No data
1167667795_1167667808 24 Left 1167667795 19:50832821-50832843 CCCTCAGTGGTGTCTGCCTCCCC No data
Right 1167667808 19:50832868-50832890 AGCTGGTCTGACTCCACTCTGGG No data
1167667795_1167667803 7 Left 1167667795 19:50832821-50832843 CCCTCAGTGGTGTCTGCCTCCCC No data
Right 1167667803 19:50832851-50832873 CTGGCAGCTCCCCGAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167667795 Original CRISPR GGGGAGGCAGACACCACTGA GGG (reversed) Intronic