ID: 1167668060

View in Genome Browser
Species Human (GRCh38)
Location 19:50834137-50834159
Sequence TAGAACCCACAATAGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167668056_1167668060 8 Left 1167668056 19:50834106-50834128 CCTTGATTCTGGATCCCGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1167668060 19:50834137-50834159 TAGAACCCACAATAGGAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 123
1167668057_1167668060 -6 Left 1167668057 19:50834120-50834142 CCCGGGGCATTCGAATCTAGAAC No data
Right 1167668060 19:50834137-50834159 TAGAACCCACAATAGGAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 123
1167668051_1167668060 30 Left 1167668051 19:50834084-50834106 CCTTTGAGTGACAGATCGTGAAC 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1167668060 19:50834137-50834159 TAGAACCCACAATAGGAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 123
1167668058_1167668060 -7 Left 1167668058 19:50834121-50834143 CCGGGGCATTCGAATCTAGAACC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1167668060 19:50834137-50834159 TAGAACCCACAATAGGAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167668060 Original CRISPR TAGAACCCACAATAGGAGCC TGG Intronic
901118926 1:6874402-6874424 TAGTACCCACTAAAGGATCCTGG + Intronic
901787825 1:11636364-11636386 CAGAACCCACAAGAAGAGCAGGG - Intergenic
902427193 1:16333315-16333337 TAAAACCCACATTAAGAGCCAGG + Intronic
902513493 1:16978406-16978428 TGGCACCCAGAATAGAAGCCAGG + Intronic
903630478 1:24765728-24765750 TAGATCCCAAAATCAGAGCCAGG + Intronic
904555768 1:31362693-31362715 TAGAAACCAGAATAGCAGTCAGG + Intronic
905485016 1:38289614-38289636 TTCAACCCTCAATAGGAGCTAGG + Intergenic
908093752 1:60715224-60715246 TAGTAAGCACAATAGGAGCCTGG + Intergenic
909455452 1:75844104-75844126 TAAAACACAAAATAAGAGCCGGG - Intronic
909542374 1:76805230-76805252 TAGAACCTACATTAGGACCAAGG - Intergenic
912105306 1:106265436-106265458 AAGAACCCACAAGAGGAAGCTGG - Intergenic
913112630 1:115670178-115670200 GAGAGCCCTCAATAGGAACCAGG + Intronic
923111455 1:230893806-230893828 GAGAACCCACCATAAGTGCCTGG - Intergenic
1064938199 10:20703916-20703938 TAGGAGCCACACCAGGAGCCAGG - Intergenic
1065918986 10:30374479-30374501 TAGAACTCAGAATAGGGGCGTGG + Intergenic
1068813190 10:61279895-61279917 TAGAACTCAATAGAGGAGCCAGG - Intergenic
1069475359 10:68727229-68727251 TAAAACCCACAAAATTAGCCGGG - Intronic
1069555910 10:69398538-69398560 CAGGACCCACAAGAGCAGCCTGG - Intronic
1069945938 10:71985631-71985653 TAGCTCCCACAACAGGAGGCAGG - Intronic
1075620477 10:123924168-123924190 TAGAACACACAGTTGGAGTCTGG - Intronic
1075654058 10:124149751-124149773 TAGCAGCCACAATAGGAGCTAGG - Intergenic
1079124058 11:17706365-17706387 TAAAACACACCATAGGGGCCAGG + Intergenic
1080112865 11:28588569-28588591 GAGAAACCACTAGAGGAGCCAGG - Intergenic
1083948434 11:65939827-65939849 TAAAACCTGCAATGGGAGCCTGG - Intergenic
1084719787 11:70897306-70897328 TATAACCCACAAAAGGAGCCAGG + Intronic
1084869902 11:72091380-72091402 CAGGACCCACAATTGGGGCCTGG - Intronic
1087583927 11:100094124-100094146 TAAAAAGCACAATGGGAGCCAGG + Intronic
1087634119 11:100684057-100684079 TAAAACCCATATGAGGAGCCAGG - Intergenic
1089003107 11:115068528-115068550 CAGAACCCACAGCAGGGGCCAGG + Intergenic
1089479635 11:118793545-118793567 TATAACCTACAAAAGGAGCCCGG + Intergenic
1091685319 12:2557413-2557435 CAGAACCTACAAAAGGATCCAGG + Intronic
1092200952 12:6582427-6582449 TAGACCCCACAAGAAGACCCAGG + Intronic
1092470852 12:8779304-8779326 CAAACCCCACAATAGCAGCCAGG - Intronic
1095977463 12:47949564-47949586 TAAAACCCACAAGAGGATCCAGG - Intergenic
1096157166 12:49347120-49347142 TAGAACCCGGGATTGGAGCCCGG + Exonic
1096793616 12:54060518-54060540 TGGAACCCAGAGGAGGAGCCTGG - Intergenic
1099903607 12:88744518-88744540 TAGAACCGACAAAATGTGCCTGG - Intergenic
1103964887 12:124632393-124632415 GGGGACCCACAATAGGAGGCAGG - Intergenic
1103991905 12:124805004-124805026 TAAAACCAACAAGAGGAGCTTGG + Intronic
1104691823 12:130832318-130832340 TATTAGGCACAATAGGAGCCTGG - Intronic
1110990344 13:82035011-82035033 TAGTACTCACAACAGGAGACTGG + Intergenic
1112230162 13:97581921-97581943 TAAAACCCATAATAAGGGCCAGG - Intergenic
1119410571 14:74427471-74427493 TAGAGTGCACAGTAGGAGCCAGG + Intergenic
1120617013 14:86719390-86719412 AAGAACACACAATAGGAGAATGG - Intergenic
1202888531 14_KI270722v1_random:132450-132472 GAGAACCCATCATAGGGGCCTGG + Intergenic
1127834461 15:62779439-62779461 TAGCACCCACAAAAGGAGGAAGG + Intronic
1128144470 15:65325080-65325102 TAGAAACCACAAAATGGGCCAGG - Intergenic
1129028984 15:72605069-72605091 TAGAACACAGAATAGGGGCATGG - Intergenic
1130721718 15:86393486-86393508 TAGAACCGAAAATAGGATACTGG + Intronic
1131656789 15:94469372-94469394 TAGATACAACAAAAGGAGCCAGG + Intronic
1135325494 16:21522915-21522937 TGGAAGCAACAGTAGGAGCCGGG + Intergenic
1137037311 16:35577711-35577733 TTGAGCCCCCACTAGGAGCCAGG + Intergenic
1138092109 16:54183168-54183190 TAGAACACCCAACATGAGCCAGG - Intergenic
1139657748 16:68399284-68399306 TTGAACCCAGAGCAGGAGCCAGG - Intronic
1140223382 16:73059426-73059448 TAGGAGCAACAATAGGAACCTGG + Intronic
1142038492 16:87877502-87877524 TGGAAGCAACAGTAGGAGCCGGG + Intergenic
1148412735 17:47481905-47481927 AAGAACCAACATTAGGAGGCTGG - Intergenic
1149012713 17:51873969-51873991 AAGAACACACAATAGAAGCCAGG - Intronic
1152566864 17:81104176-81104198 CACAACCCTCAATAGGGGCCTGG + Intronic
1154164725 18:12006251-12006273 TAGAAGCCACAATGGCAGCCGGG - Intronic
1155833653 18:30550003-30550025 TAGAACAAACAATAAGAGCCAGG - Intergenic
1156203066 18:34856144-34856166 TAGAACCCACAAAAGAACTCAGG - Intronic
1157611651 18:48960524-48960546 TAAAACCCACACAAGGGGCCGGG - Intergenic
1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG + Intergenic
1161025102 19:2033198-2033220 TAGAACCTAAACTAGGTGCCAGG + Intronic
1161798427 19:6401355-6401377 TAGAACCCAGATGAGGAGCTAGG + Intergenic
1162995403 19:14331997-14332019 TAGAAATCAGAATAGTAGCCAGG + Intergenic
1163780997 19:19248147-19248169 TAAAAACAACAATAAGAGCCAGG + Intronic
1167668060 19:50834137-50834159 TAGAACCCACAATAGGAGCCTGG + Intronic
925602453 2:5622914-5622936 TAGAACCCAGACTAGGAGGAGGG + Intergenic
926203367 2:10817360-10817382 TAGAACTCAGAATAGGCACCTGG - Intronic
929750867 2:44711886-44711908 TAGAACCAGCACTAGAAGCCAGG + Intronic
929824500 2:45299737-45299759 TAGCAGCCACCATAGCAGCCAGG + Intergenic
932265980 2:70367172-70367194 AGGTACCCCCAATAGGAGCCTGG - Intergenic
942227143 2:173827040-173827062 TAAAACCCACATTTGGGGCCAGG + Intergenic
947588165 2:231369887-231369909 TAGAAACCACAGGAGGGGCCGGG - Intronic
947902253 2:233730870-233730892 TAGATCCCACTATAGAAACCTGG - Intronic
1170216534 20:13897701-13897723 TCAAAACCACAATAAGAGCCCGG + Intronic
1175697504 20:61113664-61113686 AAGGGCCCACCATAGGAGCCAGG + Intergenic
1177238484 21:18424647-18424669 AAGAACCGACAAAAGGAGCCGGG + Intronic
1179494479 21:41763126-41763148 TGGAACCCAAAACAGGACCCAGG - Intronic
1180330656 22:11476127-11476149 GAGAACCCATCATAGGGGCCTGG + Intergenic
1185251899 22:49806700-49806722 CAGAACCCACACTAGGAGCCGGG + Intronic
949590566 3:5490173-5490195 TAGAACCCTCACTATGTGCCTGG + Intergenic
952556876 3:34541675-34541697 GAGAACTCTCCATAGGAGCCTGG - Intergenic
953323990 3:41996954-41996976 AAGAATACACAGTAGGAGCCAGG - Intergenic
956584528 3:70850474-70850496 AAGACGCCACCATAGGAGCCAGG + Intergenic
958019845 3:87981488-87981510 TAAAACCCACAATTGCGGCCAGG - Intergenic
967472974 3:189884396-189884418 TAGAAAAAACAATAGGTGCCAGG + Intronic
969598512 4:8162153-8162175 CAGAACCCCCAGTAGGACCCTGG + Intergenic
971612315 4:28741540-28741562 TGGAACCCAGAAAAGAAGCCAGG - Intergenic
972404242 4:38731357-38731379 GAGAACCCTCAAGAGGACCCCGG - Intergenic
973968888 4:56191238-56191260 TAGAACCTCCAGAAGGAGCCAGG - Intronic
976196584 4:82537852-82537874 TAGAGCCTTCAATAGGAGCAGGG + Intronic
976927080 4:90512239-90512261 TAGAACCCAGAAAAGGAGTGGGG - Intronic
978982880 4:114971599-114971621 TACAACCCACACTATAAGCCAGG - Intronic
984792305 4:183625939-183625961 AAGAACCCACACTTGTAGCCAGG - Intergenic
985664052 5:1172543-1172565 TAGAAACCACCATACGGGCCCGG + Intergenic
986597531 5:9439194-9439216 TTGAAGCCAAAAGAGGAGCCAGG + Intronic
989096805 5:37789385-37789407 TGGAAACCACAGTAGGAGTCAGG + Intergenic
989424420 5:41279594-41279616 TGGATCCGAAAATAGGAGCCTGG - Intergenic
993427643 5:87788061-87788083 TAAAACCAACAATAGCAGCATGG + Intergenic
994044193 5:95289776-95289798 CAGATCCAACAATAGAAGCCAGG + Intergenic
998000173 5:138618917-138618939 TAGAAACCACAATACAGGCCTGG + Intronic
998505614 5:142669731-142669753 GAGAACCCAGAATATGAGGCAGG + Intronic
1001603210 5:172942584-172942606 CAGAACCCATATTAGGAGCTTGG + Intronic
1005354163 6:24966727-24966749 GTGAACCCACATTAGCAGCCAGG + Intronic
1007313066 6:40962009-40962031 AAGGTCCCACAATAGGAGACTGG - Intergenic
1008991502 6:57607964-57607986 TAGAACCAAAAATTGAAGCCAGG + Intronic
1010085263 6:71909918-71909940 TAGAACACAAAAAAGCAGCCCGG + Intronic
1010123129 6:72402836-72402858 TAGAACCCACAATGGAAATCTGG - Intronic
1013600843 6:111703555-111703577 TACAACCCACAAGAGGAGACAGG - Intronic
1015965807 6:138693910-138693932 TAGAACCCTGAATTCGAGCCTGG + Intergenic
1023623685 7:42096297-42096319 TAGAATCCAGAATAGGACGCAGG + Intronic
1025012444 7:55408323-55408345 GAGAACACACAATAGGAGGGAGG + Intronic
1025024142 7:55502483-55502505 CAGCATCCACAATGGGAGCCGGG - Intronic
1026033527 7:66815529-66815551 TTGAAATCAGAATAGGAGCCAGG - Intergenic
1030689098 7:112514481-112514503 TAGCACCCACCTTAGGAACCTGG + Intergenic
1034464130 7:151215816-151215838 TTGAACCCAGAACAGGTGCCTGG - Intronic
1036630717 8:10512749-10512771 TGGAACCCAGAACAGAAGCCAGG + Intergenic
1037011119 8:13843891-13843913 CAGAACCCCCAATATGAACCAGG + Intergenic
1052914063 9:33910440-33910462 TAGAAAGCATAATAGGGGCCAGG - Intronic
1055740498 9:79383070-79383092 TAAACCCCACAATATGACCCAGG + Intergenic
1056569490 9:87803067-87803089 TGGGACCCTCCATAGGAGCCAGG - Intergenic
1057989679 9:99755644-99755666 TAGTTCCCAGAATAGAAGCCGGG - Intergenic
1059707286 9:116837144-116837166 TAGAGTCCACAAAAGGAGTCTGG + Intronic
1059945645 9:119405795-119405817 TGGAATCCACAATGGGGGCCCGG + Intergenic
1061078504 9:128355977-128355999 TAGAACACATATTAGGTGCCAGG + Intronic
1203485725 Un_GL000224v1:52370-52392 GAGAACCCATCATAGGGGCCTGG + Intergenic
1188584372 X:31755100-31755122 TAGAACCCACCCCAGGAGACTGG - Intronic
1189029854 X:37439495-37439517 TGAAGCCCAAAATAGGAGCCAGG + Intronic
1190475991 X:50827923-50827945 TAGAACCCAAAAAAGAACCCTGG + Intergenic
1192470634 X:71395860-71395882 TAGAACCTACATTTGCAGCCGGG + Intronic
1196123107 X:112071149-112071171 AAAAACCCACAATATTAGCCGGG + Intronic
1196338582 X:114569087-114569109 TAGAAACCAAAATTGGAGGCCGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197056479 X:122126431-122126453 AGGAACCCACATTAGGAGCATGG - Intergenic