ID: 1167668319

View in Genome Browser
Species Human (GRCh38)
Location 19:50835855-50835877
Sequence CAACAGAGGGAGGCGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 297}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167668319_1167668335 27 Left 1167668319 19:50835855-50835877 CCTGCAGCCGCCTCCCTCTGTTG 0: 1
1: 0
2: 2
3: 24
4: 297
Right 1167668335 19:50835905-50835927 CCGAGCCCCTGGGACTTCCTCGG 0: 1
1: 0
2: 1
3: 25
4: 336
1167668319_1167668331 2 Left 1167668319 19:50835855-50835877 CCTGCAGCCGCCTCCCTCTGTTG 0: 1
1: 0
2: 2
3: 24
4: 297
Right 1167668331 19:50835880-50835902 GCGCGGTGGTGACGAGGGAAAGG 0: 1
1: 0
2: 0
3: 4
4: 139
1167668319_1167668329 -4 Left 1167668319 19:50835855-50835877 CCTGCAGCCGCCTCCCTCTGTTG 0: 1
1: 0
2: 2
3: 24
4: 297
Right 1167668329 19:50835874-50835896 GTTGGGGCGCGGTGGTGACGAGG 0: 1
1: 0
2: 0
3: 13
4: 162
1167668319_1167668333 17 Left 1167668319 19:50835855-50835877 CCTGCAGCCGCCTCCCTCTGTTG 0: 1
1: 0
2: 2
3: 24
4: 297
Right 1167668333 19:50835895-50835917 GGGAAAGGAGCCGAGCCCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 182
1167668319_1167668332 16 Left 1167668319 19:50835855-50835877 CCTGCAGCCGCCTCCCTCTGTTG 0: 1
1: 0
2: 2
3: 24
4: 297
Right 1167668332 19:50835894-50835916 AGGGAAAGGAGCCGAGCCCCTGG 0: 1
1: 0
2: 2
3: 28
4: 251
1167668319_1167668330 -3 Left 1167668319 19:50835855-50835877 CCTGCAGCCGCCTCCCTCTGTTG 0: 1
1: 0
2: 2
3: 24
4: 297
Right 1167668330 19:50835875-50835897 TTGGGGCGCGGTGGTGACGAGGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167668319 Original CRISPR CAACAGAGGGAGGCGGCTGC AGG (reversed) Intronic
900381236 1:2385095-2385117 CAACAGGGGGAGCCGGGTGGTGG + Intronic
900561725 1:3310369-3310391 CAGCAGAGGGAGGGCGCTTCAGG - Intronic
900875128 1:5337045-5337067 CAACAGACGGAGGCGGAGGCAGG + Intergenic
901363052 1:8720595-8720617 CAACTGAGGGTGGAGGGTGCCGG + Intronic
901427330 1:9190756-9190778 GAACAGAGTGAGACGGCTCCTGG - Intergenic
901814350 1:11785337-11785359 CAGCAGGGGGAGCCTGCTGCTGG + Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902109521 1:14066631-14066653 CAACAGAGGGCGGCAACTTCAGG - Intergenic
902814910 1:18910706-18910728 CATCAGAGCCAGGCTGCTGCTGG - Intronic
903181339 1:21606349-21606371 CAACAGAGGGAGGTGGGGCCAGG + Intronic
905001127 1:34671092-34671114 CAACAGAGGGAGGAACCTGGTGG - Intergenic
906289288 1:44609620-44609642 CAACAGAGGGGGGCAGCAGAGGG + Intronic
906669694 1:47645478-47645500 CAAGAGAAGGATGGGGCTGCAGG + Intergenic
910408449 1:86914764-86914786 AAACAGCGCGAAGCGGCTGCCGG - Exonic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
913499002 1:119453419-119453441 CAGCAGTGGAAGGCTGCTGCTGG - Intergenic
916108467 1:161447291-161447313 CACCAGGGAGAGGCGGCTTCAGG + Intergenic
916110054 1:161454671-161454693 CACCAGGGAGAGGCGGCTTCAGG + Intergenic
916111640 1:161462082-161462104 CACCAGGGAGAGGCGGCTTCAGG + Intergenic
916113226 1:161469462-161469484 CACCAGGGAGAGGCGGCTTCAGG + Intergenic
917790177 1:178494397-178494419 CAACAGAGTGAGGCCCCTGGGGG + Intergenic
922421226 1:225462250-225462272 CAAAAGAGGGAGGTGGCCCCGGG - Intergenic
923964288 1:239119455-239119477 CATCAGATGGAGGTAGCTGCTGG + Intergenic
924585496 1:245357749-245357771 AGACAGAGGGAGGCTGGTGCTGG + Intronic
1063292546 10:4764311-4764333 CAGAAGAGGGAGTCGGCTGTAGG - Intergenic
1064913305 10:20427310-20427332 AAGCAGTGGGAGGAGGCTGCAGG + Intergenic
1066174889 10:32893284-32893306 CAACAGAGGGAGGCGGGAAGCGG + Intergenic
1066654132 10:37683368-37683390 CAACATAGGGAAGCAGGTGCTGG + Intergenic
1067167687 10:43878570-43878592 CGACAGGGGCAGGAGGCTGCGGG - Intergenic
1067526587 10:47042995-47043017 CAGCAGAGGGAGACTGCTGTCGG + Intergenic
1069928113 10:71865344-71865366 CAACAGGCGGAGGAGGCTGCAGG + Intergenic
1070328362 10:75402014-75402036 AAAAAGAGGGAGGCGGCGGATGG - Intergenic
1070436449 10:76398274-76398296 GAACAGAGGGAGGGAGCTGGGGG - Intronic
1070711341 10:78685373-78685395 CAACAGAAGTAGGGGGCTCCAGG - Intergenic
1070713344 10:78699606-78699628 CCAGAGAGGGAGGTGGCTGGAGG + Intergenic
1070779115 10:79127299-79127321 CATGAGAGAGAGGCCGCTGCAGG - Intronic
1071619361 10:87104903-87104925 CAACACTGGGAGGCGGAGGCAGG - Intronic
1071955073 10:90749042-90749064 CCACAGTGGGATGCAGCTGCAGG + Exonic
1072171391 10:92865515-92865537 CGACAGAGGGAGACGCCTCCCGG + Intronic
1072613753 10:97035915-97035937 CAACTCAGGGAGGCGGCTTGCGG - Intronic
1072737995 10:97891961-97891983 CAACAGAGAGAGGAGTCTGCCGG + Intronic
1073122887 10:101132891-101132913 CAGCAGAGGAAGGCGGGAGCGGG - Intronic
1073650298 10:105351648-105351670 CACCTGGGGGAGGCTGCTGCAGG - Intergenic
1074290459 10:112134313-112134335 CAACAGAAGGAGGCAGCAGGAGG + Intergenic
1074714264 10:116203547-116203569 CATCAGAGAGAGGCAGCTGGGGG + Intronic
1074772052 10:116741256-116741278 CAGCAGAGGGTGGGGGCCGCAGG + Intronic
1074779176 10:116788227-116788249 CACCAGAGGGCGGCGTTTGCAGG - Intergenic
1074908438 10:117885293-117885315 CAGGAGAGGGAGGCTGCTGTGGG - Intergenic
1076170390 10:128314524-128314546 CAACAGAAAGAGGCAACTGCAGG - Intergenic
1076618970 10:131775008-131775030 CCACAGAGTGTGGGGGCTGCAGG - Intergenic
1077056382 11:595884-595906 CAGCAGAGGGGGGCGGCGGGTGG - Intronic
1077093496 11:789871-789893 CGGGAGAGGGAGGCGGCGGCCGG - Intronic
1077100629 11:820795-820817 CATGAGAGGGAGGGGGCTGGAGG - Intronic
1077317049 11:1924253-1924275 CAGCACAGGGAGGGGGCTCCAGG - Intronic
1077320080 11:1937172-1937194 CAGGAGAGGGAGGAGGCTCCGGG - Intronic
1077382328 11:2249937-2249959 CACTAGAGGGAGGAGGCTGAGGG + Intergenic
1078576124 11:12504006-12504028 CAAGAGAGAGAGTGGGCTGCAGG + Intronic
1080162160 11:29190003-29190025 CACTGGAGGTAGGCGGCTGCTGG - Intergenic
1080568797 11:33537024-33537046 CTGCAGAGGGAGGCGACAGCCGG - Intergenic
1080631808 11:34084273-34084295 CAACAGAGGGATGAAGTTGCTGG - Intronic
1081868567 11:46372806-46372828 CAACAGGGGGTGGCGGCTTCAGG - Exonic
1083157344 11:60832283-60832305 CCACAGAGGTAGGCTGGTGCTGG + Intergenic
1083178640 11:60970494-60970516 CACCAGAGGGCAGCGGCAGCAGG + Intergenic
1083933416 11:65858056-65858078 CGCCTGAGGGAGGCGGCTGCGGG - Intronic
1084220369 11:67674244-67674266 CAGGAGAGGGAGGTGGGTGCTGG - Intronic
1084328991 11:68419055-68419077 CCACAGAGCGGGGAGGCTGCAGG - Intronic
1085057747 11:73417011-73417033 GAACAGTGGGATGTGGCTGCTGG + Intronic
1087234959 11:95707809-95707831 CAACAGCGGGAGGTGGCAGGGGG - Intergenic
1088799611 11:113293519-113293541 CAACAGAGGAAGGCGGGGGAGGG - Intergenic
1089966365 11:122656988-122657010 CAGCATAGGGTGGCGGCGGCCGG + Intronic
1091684475 12:2551788-2551810 CAGCAGGGGCAGGCGGGTGCAGG + Intronic
1091969055 12:4770975-4770997 GAACAGAGGGGGGCTGCTGGCGG + Intronic
1092065651 12:5587938-5587960 CAACGGAGGGAGGCAGCAGGGGG - Intronic
1092895080 12:13002562-13002584 CCACAGTGGGATGCAGCTGCAGG - Intergenic
1093464912 12:19439645-19439667 CGAGAGAGGGAGGCGGCGGTGGG + Intronic
1093757533 12:22869018-22869040 CAATTGAGGGAGGCAGCTGGAGG - Intergenic
1093958956 12:25251497-25251519 CAAAAGTGGGAGGCGACTTCGGG + Intergenic
1095855786 12:46859666-46859688 CAAAACAGGGAGGGGGCTTCAGG + Intergenic
1096572872 12:52533787-52533809 CCACAGAGTGAGGAGTCTGCAGG + Intergenic
1097964650 12:65565682-65565704 CAACAAAGGAATGCGGTTGCTGG - Intergenic
1098219487 12:68253377-68253399 CAAGAGAAGGAGGCAGCTGGTGG + Exonic
1098893812 12:76035072-76035094 CAACTGAGAAAGGGGGCTGCAGG - Intergenic
1101090872 12:101283794-101283816 CAACAGTGGGAGGCTGAGGCAGG - Intronic
1101866639 12:108525117-108525139 GGACAGAGGGAGAAGGCTGCAGG + Intronic
1102673924 12:114643585-114643607 AAACAAAGGCAGGAGGCTGCTGG - Intergenic
1103698518 12:122835528-122835550 CAAAAGCGGGCGGCGGCGGCAGG + Exonic
1104092263 12:125526793-125526815 TGGCAGAGGGAGGCGGCTGTGGG + Intronic
1104216773 12:126741529-126741551 CAACAGAGGAAGGTGTCTGGGGG + Intergenic
1105811154 13:23996817-23996839 GGTCAGAGGGAGGCGACTGCTGG - Intronic
1106340835 13:28825020-28825042 GAGCACAGGGAGGCAGCTGCAGG + Intronic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1107787295 13:43969530-43969552 CAACAGGGGGTGGCGGCTTCAGG - Intergenic
1108585378 13:51866035-51866057 CAACAGAGGGCAGCGCTTGCTGG + Exonic
1109704091 13:66066289-66066311 CAACAGAGGGAGGGGGTTTAGGG + Intergenic
1113464819 13:110505790-110505812 CAGCGGAGGGAGGCCACTGCTGG + Intronic
1115004742 14:28468322-28468344 CAACAAAGGCATGCAGCTGCAGG + Intergenic
1116863455 14:50012764-50012786 CAAGGGAGGGAGGGAGCTGCAGG - Intergenic
1118093725 14:62512899-62512921 CAACAAAGGGCGGCGTTTGCAGG + Intergenic
1118301898 14:64623813-64623835 CAACAGATGGAAGCGGGTGTGGG - Intergenic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1119616413 14:76101832-76101854 CAAGAGAGGGAAGGGCCTGCAGG - Intergenic
1119644386 14:76337959-76337981 AATCAGAGACAGGCGGCTGCAGG - Intronic
1122081889 14:99272492-99272514 CAACAGCGGGAGGGGGTTGGGGG + Intergenic
1122388646 14:101365423-101365445 CATCAGGGTGAGGCGGCTGGTGG + Intergenic
1127520660 15:59740211-59740233 CAACTGGGGGAGGAGGCTACTGG + Intergenic
1128976709 15:72159609-72159631 CAACAGAGGCAGAGGGCTGTGGG + Intergenic
1129267466 15:74401659-74401681 CCCCAGAGGGAGGCGCCTGCAGG - Intergenic
1131118597 15:89809281-89809303 CAAAGGTGGGAGGGGGCTGCAGG - Intronic
1132514585 16:360206-360228 AAGCAGAGGGAGGCGGCGGAGGG - Intergenic
1132796902 16:1729046-1729068 CCACAGAGGGAGGGGGTTCCAGG - Intronic
1132860908 16:2071303-2071325 CAAGGGAGGGAGGAGGCTGTGGG + Intronic
1135471167 16:22732481-22732503 CAACAGAGGGAGGCAGATGAGGG - Intergenic
1135685818 16:24497612-24497634 CAAGAGAGGGAGGGAGGTGCTGG - Intergenic
1137031210 16:35526333-35526355 CAACAAACGGAAGCGGCAGCTGG + Intergenic
1138412654 16:56852213-56852235 CAACAGCGGGAGGCGGAGGATGG + Intergenic
1138472946 16:57252609-57252631 GAACAGAGGGTGGTGGCGGCGGG - Exonic
1138548575 16:57734893-57734915 CAACAGGGAGAGGCGGCTGCGGG + Intergenic
1140206846 16:72940156-72940178 CAACACAGGGAGGCTGAGGCAGG - Intronic
1141099340 16:81185592-81185614 CAGCAGAGTCAGGCGGCGGCAGG + Intergenic
1141199201 16:81883958-81883980 TCACAGCGGGAGGCTGCTGCCGG + Intronic
1142498271 17:317930-317952 CAACAGAGGGTGGAGGGTGGAGG - Intronic
1143716023 17:8769607-8769629 CAACAGAGGGAGGCAGCCCTTGG + Intergenic
1144147625 17:12413703-12413725 CAAGAGTGGGAGGCGGGTGAGGG - Intergenic
1144624233 17:16836616-16836638 CAGCAGAGGGAGGCACCAGCAGG + Intergenic
1144691708 17:17270532-17270554 CACCTCAGGGAGGCTGCTGCTGG - Intronic
1144882194 17:18436103-18436125 CAGCAGAGGGAGGCACCAGCAGG - Intergenic
1145150039 17:20508283-20508305 CAGCAGAGGGAGGCACCAGCAGG + Intergenic
1146034099 17:29390839-29390861 CAACAAGGGGCGGCGGCGGCGGG - Exonic
1146354204 17:32120336-32120358 AAACAGAGGGAAGGGGCTGCTGG + Intergenic
1147420254 17:40318899-40318921 CACCAGAGGGAGCCGGCCGGGGG + Intronic
1147743706 17:42682792-42682814 GTTCACAGGGAGGCGGCTGCCGG + Exonic
1148994536 17:51698069-51698091 CCACAGAGGGCAGCAGCTGCTGG - Intronic
1150134555 17:62688800-62688822 TAGCACAGGGAGGCAGCTGCTGG + Intronic
1151141160 17:71993364-71993386 AAACAGTGGGAAGAGGCTGCAGG - Intergenic
1151500252 17:74483772-74483794 CATCAGAGGCAGGAGGCTCCGGG - Intronic
1152306025 17:79520558-79520580 GAGCAGAGGGAGACGGCTGGTGG - Intergenic
1152921375 17:83068184-83068206 CGACAGCGGGGGGCGGCAGCGGG + Intergenic
1152921622 17:83068834-83068856 CGACAGCGGGGGGCGGCAGCGGG + Intergenic
1154041419 18:10859825-10859847 GAGCAGAGGGAGGCAGCAGCGGG + Intronic
1155237885 18:23839872-23839894 CAACAGAAGGTGACGACTGCTGG - Exonic
1155307308 18:24490896-24490918 CAAAAGAGGGTGGCTGCTTCAGG + Intergenic
1156482379 18:37444401-37444423 CAACCGTGGGAGGAGGCAGCGGG + Intronic
1157442123 18:47719299-47719321 CAGCAGGGGGAGGTGGCTGAGGG - Intergenic
1159106059 18:64002835-64002857 CCACAGACGGCGGCGACTGCAGG - Intronic
1160861055 19:1237398-1237420 CTCCTGGGGGAGGCGGCTGCGGG + Intronic
1160975136 19:1789343-1789365 CAAGAGTGGGTGGCGGCGGCGGG - Exonic
1161269575 19:3382416-3382438 CATCTGAGGGAGGAGGCTGGTGG + Intronic
1161572184 19:5036597-5036619 CAACAGTGAGAGGCAGATGCCGG - Intronic
1161737943 19:6002957-6002979 CAACACAGGGAGGAGGGAGCAGG + Intronic
1162819139 19:13212277-13212299 CTGCAGAGGGAGGGAGCTGCAGG + Intronic
1163763848 19:19151529-19151551 GTACAGAGGGCGGCGGCTGCAGG - Intronic
1165780901 19:38433771-38433793 GAACAGAGGGAGGGGGCTGCGGG - Intronic
1165815395 19:38638887-38638909 CAACAGTGGGAGGCTGCAGCAGG + Intergenic
1166306223 19:41938400-41938422 AGACTGAGGGAGGAGGCTGCTGG - Intergenic
1166306344 19:41938736-41938758 AGACTGAGGGAGGAGGCTGCTGG - Intergenic
1166306366 19:41938810-41938832 AGACTGAGGGAGGAGGCTGCTGG - Intergenic
1166306553 19:41939330-41939352 AGACTGAGGGAGGAGGCTGCTGG - Intergenic
1167080834 19:47275181-47275203 CAGGAGAGGGAGGCAGCGGCGGG - Exonic
1167387487 19:49172296-49172318 CAACAGAGGAAAGCAGATGCTGG - Intronic
1167638633 19:50668527-50668549 CCACGGCGGGCGGCGGCTGCGGG + Exonic
1167668319 19:50835855-50835877 CAACAGAGGGAGGCGGCTGCAGG - Intronic
925326194 2:3023810-3023832 CAAAAGATGGAGGAGGCAGCGGG + Intergenic
925362386 2:3288638-3288660 CATCAGAGGGTGGCAGCTGCTGG + Intronic
925646045 2:6037769-6037791 CTACAGAGGCATGGGGCTGCTGG - Intergenic
927909886 2:26889863-26889885 CAACAAAGGGAGGACGTTGCTGG - Intronic
929864778 2:45708802-45708824 CAACAGAGGGAGAAGGCACCTGG - Intronic
929898590 2:45982742-45982764 GAACAGAGGGAGGAGGATGAAGG - Intronic
931250720 2:60528640-60528662 TAGCAGAGGGTGGCGGCCGCAGG + Intronic
931695722 2:64869212-64869234 CAGCAGAGGGTGAGGGCTGCGGG + Intergenic
932861521 2:75297580-75297602 AAATAGAGGGAGGCAGCTGGTGG + Intergenic
932885944 2:75549413-75549435 CATCAGAGGGAAGAAGCTGCAGG - Intronic
934851808 2:97706762-97706784 GCGCAGAGGGAAGCGGCTGCTGG - Intergenic
936267663 2:111022754-111022776 CAGCAGAGGGAGGCGAGGGCAGG + Intronic
937249210 2:120512622-120512644 CAGCAGAGGGAGGAAGCTGAGGG - Intergenic
937865509 2:126748501-126748523 CAAGAGGGGAAGGCGGGTGCAGG - Intergenic
937986551 2:127640626-127640648 CAAGGGAGGGAGGGGGTTGCTGG + Intronic
938957794 2:136314819-136314841 CAACAGAGTGAGACGCCTTCTGG - Intergenic
938967985 2:136405198-136405220 CCACATAGGAAGGCGGCTGTAGG + Intergenic
944894570 2:204150963-204150985 CAGCAGAGGGAAGCTGCGGCAGG + Intergenic
945594818 2:211778247-211778269 GAACACAGGGGGGCGGCGGCGGG - Intronic
945974387 2:216259208-216259230 CAACAGAGGGAGCAGGCAGAGGG - Exonic
946025883 2:216671396-216671418 CAACACAGTGAGGCGGCAGAAGG + Intergenic
946072836 2:217049004-217049026 GAGCAGAGGGAGGCAGCAGCAGG - Intergenic
946382469 2:219358485-219358507 CAACCTGGGGAGGCGGCTGGGGG - Intergenic
948107656 2:235428132-235428154 TAACAGAGCGATGGGGCTGCTGG - Intergenic
948125513 2:235562384-235562406 CACAAGAGGGAGGGGGCTTCGGG - Intronic
948329533 2:237154254-237154276 AAACACAGGGAGGTGGCTGCAGG + Intergenic
948899105 2:240947235-240947257 AACCTGAGGGAGGCTGCTGCGGG + Intronic
1169548532 20:6676518-6676540 AAACAGAGGGAGGCCGAGGCAGG - Intergenic
1170001366 20:11618290-11618312 AATCTGAGGGAGACGGCTGCCGG - Intergenic
1170459473 20:16563978-16564000 CAAGGGAGGGAAGGGGCTGCTGG - Intronic
1171090695 20:22283484-22283506 CACCAGAGAGAAGCGGATGCAGG - Intergenic
1171370067 20:24656736-24656758 CCTGAGAGGGAGGGGGCTGCGGG - Intronic
1174150223 20:48481193-48481215 CAGCATAGGGAGGCAGCTGGAGG - Intergenic
1176085937 20:63295527-63295549 CACCAGTGGGAGGCGGCGGTGGG - Intronic
1176194973 20:63832521-63832543 CGGCAGTGGGAGGCGGCTGAGGG + Intergenic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1177773499 21:25543607-25543629 CAAGAGAGGGAGTCGGGTGTGGG + Intergenic
1178407436 21:32336119-32336141 CAAAAGAGCGAGGCTGCCGCAGG + Intronic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1179974676 21:44857704-44857726 CAGCAGAGGGGTGAGGCTGCGGG - Intronic
1180945670 22:19691771-19691793 CAGCCGAGGGAGGCGGCTTTTGG + Intergenic
1181465960 22:23110764-23110786 CAGCAGAGGGAGGAAGCAGCTGG + Intronic
1181494476 22:23280254-23280276 CAACAGCTGGAGGAGGCAGCTGG + Intronic
1182083020 22:27542704-27542726 CAACTGGAGGGGGCGGCTGCTGG - Intergenic
1183950794 22:41351605-41351627 CAGCAGATGGAGGCGCATGCGGG + Exonic
1185210655 22:49568850-49568872 ACACAGAGGGAAGCGGCTGCAGG - Intronic
1185241298 22:49748983-49749005 CCCCAGAGGAAGGAGGCTGCAGG + Intergenic
1185291098 22:50028257-50028279 CACCAGCGGGAGGCAGCTGGAGG - Intronic
950441605 3:13014062-13014084 CAACAAAGGCAGGTTGCTGCTGG + Intronic
951558654 3:23945378-23945400 CGAGAGAGGGTGGCGGCGGCCGG - Exonic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
952255054 3:31687823-31687845 CAACAGTGGGAGGCTGAGGCAGG + Intronic
952328367 3:32341186-32341208 CAACAGTGGTGGGCAGCTGCCGG + Intronic
952647801 3:35682838-35682860 CAACATACAGAGGCGGCTGGAGG + Exonic
952824932 3:37516881-37516903 CAACAGAGGGAGGGGGTTAATGG - Intronic
952886004 3:38011264-38011286 CAGCAGCGGGAGGAGGCGGCAGG - Exonic
953399478 3:42600573-42600595 CAACCGAAGGTGGCGGCAGCGGG - Intronic
954707877 3:52490665-52490687 GGACAGAGGGAGGCGGTGGCAGG - Intronic
955893449 3:63674744-63674766 CAACAGAGAGATGCAGGTGCTGG - Intronic
960920405 3:122740988-122741010 CCACTGAGGTAGGCGGCTTCTGG - Exonic
961022613 3:123521660-123521682 CACCACAGGGAGGAGGGTGCAGG + Intronic
961445573 3:126979489-126979511 AAACAGAGGGCAGCTGCTGCCGG + Intergenic
961506045 3:127371164-127371186 GAGCAGGGGGAGCCGGCTGCAGG + Intergenic
961745595 3:129061891-129061913 CAGCAGAAGGTGGCGGGTGCGGG - Exonic
961830161 3:129619191-129619213 GAACAGGGGCAGGCGGCCGCCGG + Intergenic
964282346 3:155080099-155080121 CAGCCGAGGGGAGCGGCTGCCGG + Intronic
966702578 3:182871663-182871685 CAAGAGAGAGAGACAGCTGCAGG - Intronic
968242016 3:197098552-197098574 CAACAGAGCGAGGTGGGGGCGGG - Intronic
968647518 4:1748049-1748071 CAGCCCAGGGAGGCAGCTGCAGG - Intergenic
968978702 4:3835249-3835271 GGACACAGGGAGGCGGCTCCTGG - Intergenic
969457359 4:7307633-7307655 CATCAGAGGGAAGCGGCTGAGGG + Intronic
969587047 4:8100076-8100098 CAGGAGAGGGTGGCGGCTGGGGG + Intronic
969669567 4:8582249-8582271 CAACTGAGGCAGGCTGCTGATGG - Intronic
969826786 4:9764107-9764129 CTCCAGAGGAAGGCGGCTCCAGG - Intergenic
970654229 4:18213465-18213487 AAGCAGTGGGAGGCGGCTGTGGG + Intergenic
975815125 4:78209428-78209450 CAACAGAGGGAGGGAGCTGGAGG - Intronic
982110796 4:152051673-152051695 CAACACAGGGAGGCCGAGGCAGG - Intergenic
982761869 4:159294389-159294411 CTGGAGAGGGAGGCAGCTGCTGG - Intronic
985525376 5:398855-398877 GAACAGACGGGGGCGGCTGCTGG - Intronic
985563463 5:603572-603594 GGACAGAGGGAGCTGGCTGCTGG - Intergenic
985563492 5:603701-603723 GGACAGAGGGAGCCGGCTGCTGG - Intergenic
985692889 5:1323335-1323357 CAACAGAGGCTGGGGGCTCCGGG + Intronic
985962949 5:3316751-3316773 CTGCAGAGGGATGGGGCTGCTGG - Intergenic
988500082 5:31777064-31777086 AAGCAGAGGGAGCCGGCTCCAGG - Intronic
989104591 5:37849612-37849634 CCACAGAGCGAGGCGGCAGAGGG + Intergenic
995484199 5:112622564-112622586 GTCCAGAGGGAGGTGGCTGCAGG - Intergenic
999850241 5:155529700-155529722 CATCAGAAGGAGGAGGATGCTGG + Intergenic
1001155972 5:169272745-169272767 AAAGAGATGGAGGTGGCTGCAGG + Intronic
1001529237 5:172450915-172450937 CAACAGAGGGCAGTGGCTCCAGG + Intronic
1003115346 6:3280287-3280309 CCACACAGGGAGGCGGCCTCAGG + Intronic
1003618914 6:7680175-7680197 CAACAGACGGAGGGGGATGGGGG + Intergenic
1004072467 6:12313341-12313363 CAACAGAGGTAGGTTGATGCTGG - Intergenic
1006137450 6:31903848-31903870 CAACAGAGGGAACTGGGTGCGGG - Intronic
1006647327 6:35523605-35523627 CAACAGTGGGAGGCCGAGGCAGG + Intergenic
1007502047 6:42305741-42305763 GAACAGGGGGAGGGGGATGCAGG + Intronic
1007751202 6:44073031-44073053 CAGCAGAGGCAGGCGGGTGAGGG + Intergenic
1013601305 6:111707567-111707589 CAACAGAGGGAGTGGACTGCGGG + Intronic
1016921547 6:149299760-149299782 CAACACTGGGAGGCGGGGGCAGG + Intronic
1017493299 6:154962840-154962862 CCACAGTGGGAGGCGGGGGCTGG - Intronic
1018617734 6:165703825-165703847 GAACAAGGGGAGGCGGCTGTCGG - Intronic
1018721273 6:166574326-166574348 CAACAGACGCTGGGGGCTGCTGG - Intronic
1019050190 6:169176786-169176808 GGTCAGAGGGAGGAGGCTGCAGG + Intergenic
1020095240 7:5364782-5364804 CAACAGAGGGAGGCTGTCTCAGG + Intronic
1020106256 7:5423564-5423586 AAAAAGTGTGAGGCGGCTGCGGG - Intronic
1020242003 7:6402234-6402256 CACCAGCGGGAGGCAGCTCCTGG - Intronic
1021411173 7:20331123-20331145 CAACAGGGGGAGGCGGCTCTGGG - Exonic
1021919293 7:25467929-25467951 CTACAGAGGGAGGTGGGTGGAGG - Intergenic
1024417602 7:49125475-49125497 AAACAGAGGCAGGAGGCTGTAGG + Intergenic
1025110077 7:56209016-56209038 CAACAGAGAGAGAAGTCTGCAGG - Intergenic
1026047677 7:66918689-66918711 CAACAGTGGGAGGCTGAGGCAGG - Intergenic
1027774186 7:82443953-82443975 AGTCAGAGGGAGGCGGCTGGGGG + Intergenic
1029284549 7:99456777-99456799 CCAGGGAGGGAGGCAGCTGCTGG + Exonic
1031934149 7:127718607-127718629 CAGCAGAGAGAGTCTGCTGCTGG + Intronic
1034256525 7:149727753-149727775 CAACAGAGGGAGCCGGGAGTTGG - Intronic
1034740698 7:153470992-153471014 CAAGAGTGGCAGGAGGCTGCTGG + Intergenic
1035121573 7:156572837-156572859 CCCCAGAGGGAGGAGGCTGTGGG - Intergenic
1036752298 8:11451042-11451064 CAGAAGAGGGAGGAAGCTGCTGG - Intronic
1036757769 8:11482637-11482659 CAACAGAGGGTGCCAGCTCCTGG + Intergenic
1039547667 8:38421453-38421475 CAGCGGAGGGGGGAGGCTGCTGG + Intronic
1041693186 8:60710124-60710146 CAACAGTGGGAGGAGGCAGTGGG + Intronic
1045337932 8:101224744-101224766 CAACTGTGGGAGGAGGCTGAAGG - Intergenic
1045508474 8:102795156-102795178 AAGCAGAGGGAGGCAGCTGACGG - Intergenic
1047998520 8:130358399-130358421 GAGCAGAGGGAGGCGGGTCCCGG - Intronic
1048021876 8:130546893-130546915 CCAGAGAGGGAGGCGGCTAGAGG + Intergenic
1048653752 8:136511961-136511983 CAACAGCTGGAGGCAGCTCCAGG + Intergenic
1049185452 8:141249524-141249546 CAACAGAGGCAGGCTGGTGGTGG + Intronic
1049602902 8:143516109-143516131 CAACCGAGGCAGGGGGCGGCTGG + Intronic
1050574942 9:6985070-6985092 CAGCAGAGGGAGTCGGATTCTGG - Intronic
1051593349 9:18798702-18798724 CAACAGAGAGAGACGCCTGATGG + Intronic
1053139513 9:35673976-35673998 CAACAGAGGGAGCCAGGGGCTGG - Exonic
1053343471 9:37360371-37360393 CAACAAAAGGAGGATGCTGCTGG + Intergenic
1053459548 9:38257866-38257888 TAAAAGGAGGAGGCGGCTGCAGG + Intergenic
1054266845 9:62925867-62925889 CAGCAGGGGGTGGCGGGTGCAGG + Intergenic
1054550338 9:66595321-66595343 CAGCAGGGGGTGGCGGGTGCAGG + Intergenic
1055000810 9:71447102-71447124 CCAGAGAAGGCGGCGGCTGCCGG - Intergenic
1055131378 9:72778910-72778932 AAGCAGAGGGGGGAGGCTGCAGG - Intronic
1056331226 9:85522849-85522871 CAGCAGAGAGAGGCCGATGCGGG - Intergenic
1056623857 9:88237737-88237759 CCAGGGAGGGAGGTGGCTGCTGG - Intergenic
1057147084 9:92765313-92765335 CCCCAGGGGGAGGCGGGTGCGGG + Intergenic
1059958860 9:119545615-119545637 TAACAGAGGGTGGGGGCTGATGG + Intergenic
1061376224 9:130226362-130226384 GAGCAGAGAGAGGCGGCTGAGGG - Intronic
1061407580 9:130400963-130400985 CCACAGAGAGAGGCAGCTGAGGG + Intronic
1061938807 9:133873091-133873113 CGACAGAGGGAGGGGGCGGGGGG + Intronic
1062321634 9:135993143-135993165 GAGCACAGGGAGGCTGCTGCTGG + Intergenic
1062586586 9:137252431-137252453 CTACAGAGGGCGGTGGCCGCAGG + Exonic
1062694476 9:137866454-137866476 CAACAGAGGGCAGGGGCTGAGGG - Intronic
1203772757 EBV:57932-57954 GGACAGAGGGAGGCGGCGGCCGG + Intergenic
1186452540 X:9685462-9685484 AAGCAGAGGGAGGAAGCTGCAGG - Intronic
1189305557 X:39984352-39984374 CAACAGAAGGATGAGGCAGCTGG + Intergenic
1190291206 X:48993517-48993539 CAACTGAAGGAGGGGGCTGCAGG - Exonic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1196020789 X:110988794-110988816 CAAGTTAGGGAGGCGGCTGCAGG + Intronic
1198512479 X:137366474-137366496 CAGCAGGAGCAGGCGGCTGCTGG - Intergenic
1200034696 X:153319786-153319808 GGAGAGAAGGAGGCGGCTGCTGG - Intergenic
1200034990 X:153321213-153321235 CAAAAGAGGGAGGGGGCTCCTGG - Intergenic