ID: 1167669005

View in Genome Browser
Species Human (GRCh38)
Location 19:50839025-50839047
Sequence GCCCGCACTCCTGGGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167668997_1167669005 5 Left 1167668997 19:50838997-50839019 CCTGGGTCTGAGGGAGGAGGGGC 0: 488
1: 393
2: 276
3: 259
4: 884
Right 1167669005 19:50839025-50839047 GCCCGCACTCCTGGGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167669005 Original CRISPR GCCCGCACTCCTGGGTCTGA GGG Intergenic
No off target data available for this crispr