ID: 1167670420

View in Genome Browser
Species Human (GRCh38)
Location 19:50849662-50849684
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167670420_1167670425 26 Left 1167670420 19:50849662-50849684 CCCCTCTAGAAATCTAGCTGATA No data
Right 1167670425 19:50849711-50849733 AATCACACCGTTAGACTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167670420 Original CRISPR TATCAGCTAGATTTCTAGAG GGG (reversed) Intergenic
No off target data available for this crispr