ID: 1167672257

View in Genome Browser
Species Human (GRCh38)
Location 19:50859965-50859987
Sequence GGCCCCCAGAATCACCCTAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167672257_1167672264 19 Left 1167672257 19:50859965-50859987 CCCTTAGGGTGATTCTGGGGGCC 0: 1
1: 1
2: 1
3: 15
4: 97
Right 1167672264 19:50860007-50860029 GCTTCAAGGTATCACGTCATGGG 0: 1
1: 1
2: 1
3: 3
4: 35
1167672257_1167672259 -7 Left 1167672257 19:50859965-50859987 CCCTTAGGGTGATTCTGGGGGCC 0: 1
1: 1
2: 1
3: 15
4: 97
Right 1167672259 19:50859981-50860003 GGGGGCCCACTTGTCTGTAATGG 0: 1
1: 1
2: 0
3: 5
4: 56
1167672257_1167672262 5 Left 1167672257 19:50859965-50859987 CCCTTAGGGTGATTCTGGGGGCC 0: 1
1: 1
2: 1
3: 15
4: 97
Right 1167672262 19:50859993-50860015 GTCTGTAATGGTGTGCTTCAAGG 0: 2
1: 0
2: 0
3: 7
4: 98
1167672257_1167672265 20 Left 1167672257 19:50859965-50859987 CCCTTAGGGTGATTCTGGGGGCC 0: 1
1: 1
2: 1
3: 15
4: 97
Right 1167672265 19:50860008-50860030 CTTCAAGGTATCACGTCATGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
1167672257_1167672263 18 Left 1167672257 19:50859965-50859987 CCCTTAGGGTGATTCTGGGGGCC 0: 1
1: 1
2: 1
3: 15
4: 97
Right 1167672263 19:50860006-50860028 TGCTTCAAGGTATCACGTCATGG 0: 1
1: 1
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167672257 Original CRISPR GGCCCCCAGAATCACCCTAA GGG (reversed) Exonic
901927296 1:12574470-12574492 GGGCCTCAGAATCACCATCATGG - Intronic
904037364 1:27566019-27566041 GGGCTCCAGAGTCACCCCAAAGG - Intronic
906710705 1:47927631-47927653 GGCCCCCATATTTCCCCTAATGG - Intronic
907108318 1:51904139-51904161 AATCCTCAGAATCACCCTAAGGG + Intergenic
910424873 1:87111462-87111484 GGCACCCAGAATCATCAAAATGG - Intronic
912858209 1:113190561-113190583 GGCCTCCAAAATCTCCCTAAGGG - Intergenic
912926519 1:113917990-113918012 GTCACCCAGCCTCACCCTAAAGG + Intergenic
920055360 1:203186926-203186948 GCCCCCCATCATCACCCTAGTGG - Intergenic
923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG + Intronic
1062973261 10:1664758-1664780 GGCCCCCAGAGTCAGCCGCATGG - Intronic
1064242957 10:13647210-13647232 GGCCCCCAGAATCCACACAAAGG + Intronic
1067777189 10:49172219-49172241 GGCCCCCTGGAACACCCTATAGG - Intronic
1069923339 10:71831079-71831101 GGGCCCCAGAAGCACCTTCAAGG + Intronic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1071899264 10:90101474-90101496 TGGCCTCAGAATCACCCTTAGGG - Intergenic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG + Intergenic
1077300323 11:1843772-1843794 GGACACCAGAATCACCCGAGAGG - Intergenic
1080169436 11:29281714-29281736 TGCCCCCACACACACCCTAATGG - Intergenic
1083142475 11:60733433-60733455 GTGCCCCAGAATCACCCCAGGGG - Intronic
1083550889 11:63589552-63589574 GTCTCCCAGATTCACCCTTAGGG + Intronic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1085260052 11:75199504-75199526 GGCCCCCAGCATCCACCTCAGGG + Intronic
1086395146 11:86407956-86407978 GGACCCCAGAAATACTCTAAAGG - Intronic
1086945274 11:92838657-92838679 TGGCCTCAGAATCACCCCAAAGG + Intronic
1087743437 11:101915235-101915257 CGCCCCCAGAACCTCCCTCATGG - Exonic
1088848914 11:113689902-113689924 GGCCCCCGCTATCTCCCTAAGGG + Exonic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1103714328 12:122935220-122935242 GGCCCACAGGGTCACCCTCAGGG - Intronic
1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG + Intronic
1107836707 13:44417598-44417620 TGCCTCCAGCATCACCCGAATGG + Intergenic
1108321377 13:49294184-49294206 GGTCACCAGAATCACCCGCAAGG - Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1118710052 14:68511421-68511443 AGCTCCCAGAATCACCCTAGGGG + Intronic
1118815701 14:69312402-69312424 GGCCCCAAGAAACACCCTCTGGG - Intronic
1120434031 14:84457249-84457271 GGCCCTAAAAATCACTCTAAAGG - Intergenic
1121208480 14:92188721-92188743 AGCCCACATAATAACCCTAAGGG - Intergenic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1122944270 14:104998803-104998825 TGCCCCCAGGAGCACCCTACTGG + Intronic
1132754117 16:1474495-1474517 GTCCCCCAGACTGGCCCTAAAGG - Intronic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1140201950 16:72902203-72902225 TGCTCCCAGAATCATCCTAACGG + Intronic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1142211659 16:88811437-88811459 CGCCCCCTGAAGCACCCCAAAGG + Intronic
1143602521 17:7957981-7958003 TGCCACCAAAATCATCCTAATGG - Intergenic
1145017116 17:19406468-19406490 AGCCCCCAGCAGCACCCTGAGGG + Intergenic
1148676732 17:49449966-49449988 GTCACCCAGAAACACCCTCACGG - Intronic
1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG + Exonic
1154130604 18:11733992-11734014 GGCCCCCAGCCTCACCAGAAGGG + Intronic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161036910 19:2090045-2090067 GGCCCCCAGAATCCCCTCAGTGG - Intronic
1167653787 19:50749709-50749731 GGCCCCCCGTATCCCCCTTAAGG + Intergenic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167689695 19:50977676-50977698 GTCCCCCTGAGTCACCCTAGAGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
1167966266 19:53149763-53149785 AGCCCCCATAATAACCCGAAAGG + Intronic
1168287414 19:55341490-55341512 GGCAGCCGGGATCACCCTAAAGG - Intronic
928306853 2:30177423-30177445 GGCCACCATAATAACCCTGAAGG - Intergenic
932779929 2:74553654-74553676 GGCCGCCAGGAGCGCCCTAAGGG - Intronic
938989004 2:136608871-136608893 AGCCTCCAGAAGCAGCCTAAGGG - Intergenic
948141112 2:235671929-235671951 CACCCCCAGAATCCCCCTCAGGG - Intronic
1172633929 20:36396711-36396733 GGCCCCTGGAATCACCCCAGAGG - Intronic
1173480827 20:43397992-43398014 GGCTCCCAGATTCTCCCTGACGG + Intergenic
1173904919 20:46619561-46619583 GGCCCCCAGACTCACAGTCATGG + Intronic
1174297771 20:49561209-49561231 TGCCCCCAGTATAACCCAAAGGG + Intronic
1176385530 21:6137137-6137159 GGCCCCCAGAAACAACCTTGGGG + Intergenic
1179737943 21:43401115-43401137 GGCCCCCAGAAACAACCTTGGGG - Intergenic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1185068161 22:48642255-48642277 GGACCCCAGAACCTCCCAAATGG + Intronic
951832828 3:26949633-26949655 GCCCCCTAGAATCACCAGAAAGG + Intergenic
955812981 3:62810814-62810836 CGCCCTCACAATCGCCCTAATGG - Intronic
959895776 3:111604220-111604242 GGCTCTCAGAACCACCCTCATGG - Intronic
960005280 3:112775370-112775392 GGGAATCAGAATCACCCTAATGG + Intronic
966845958 3:184130057-184130079 GGCCCCAAGACTTACCCTCAAGG + Intergenic
969657838 4:8508359-8508381 GGCACCCAGACCCACCCTCAGGG - Intergenic
974943459 4:68496636-68496658 GTCCTCCAGAGTCACCCTAAAGG - Exonic
977201710 4:94123974-94123996 GGTCCTCAAAATTACCCTAAAGG - Intergenic
978318530 4:107466986-107467008 GGCCCCCACAGTCACCTTGAGGG + Intergenic
978359632 4:107916448-107916470 GGCACACAGAATCACTCAAATGG - Intergenic
983065440 4:163205263-163205285 GGACCCCAGTATGACCCCAAAGG + Intergenic
983250211 4:165335506-165335528 GGCAGCCACAATCACCCTAAAGG - Intronic
989564849 5:42891989-42892011 TGCCCCCAAAATCACCCTTTGGG - Intergenic
999341974 5:150780180-150780202 GACCCTCTGAATTACCCTAATGG + Intronic
999979413 5:156943703-156943725 GGCCCCCAGTTTCTCCCAAAAGG - Intronic
1000158471 5:158575484-158575506 GGCCCCCATAATAGCACTAAAGG + Intergenic
1003019899 6:2500654-2500676 GCCCCCCTCAATCACCCCAATGG - Intergenic
1006144683 6:31951547-31951569 GGCCGCCAGAATCACCTGCAAGG - Exonic
1006556429 6:34871095-34871117 GAACTCCAGCATCACCCTAAAGG + Exonic
1007601743 6:43086346-43086368 GGCCCCCATAACCACCCCCAGGG - Intronic
1011416718 6:87129605-87129627 GGCCCCCAGAATCCCACTGTAGG + Intergenic
1016915626 6:149241921-149241943 GGCCCCCAGGAGCAGCCTTACGG - Intronic
1017706297 6:157126139-157126161 GGCTCACAGAATCACTATAAAGG + Intronic
1018179908 6:161213961-161213983 GGCCCCCAAAATCACTTAAAGGG + Intronic
1020002471 7:4763664-4763686 GGACCCCAGAACCACCCAACTGG - Exonic
1029999598 7:105044957-105044979 GGCTCCCAGTATCACCTGAAGGG + Intronic
1030922847 7:115414136-115414158 GGCCCAGAAAATCACCCAAAAGG + Intergenic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1035456453 7:159012411-159012433 TGCCCCAAGAATCACATTAATGG - Intergenic
1038908333 8:31933242-31933264 GGTCCCCACAATAACCCTGATGG + Intronic
1044392156 8:91663716-91663738 GGACCCCAGAATCCCCTTACAGG + Intergenic
1047690527 8:127348969-127348991 GGGCACCAGAATCACCCAGAGGG - Intergenic
1049794763 8:144492080-144492102 GGCCCCCAGAACCAGCCGGAGGG + Intronic
1060890947 9:127187959-127187981 GGCCCACAGAATCAACCTCCAGG + Intronic
1062103006 9:134738143-134738165 GGCTCCCTGCATCACCCCAAAGG - Intronic
1185633378 X:1534406-1534428 TGCCCCCAGGATCACCCCCAAGG - Intronic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1193406621 X:81108697-81108719 TGTCCCCAGAAACACCCAAATGG - Intergenic