ID: 1167672259

View in Genome Browser
Species Human (GRCh38)
Location 19:50859981-50860003
Sequence GGGGGCCCACTTGTCTGTAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167672257_1167672259 -7 Left 1167672257 19:50859965-50859987 CCCTTAGGGTGATTCTGGGGGCC 0: 1
1: 1
2: 1
3: 15
4: 97
Right 1167672259 19:50859981-50860003 GGGGGCCCACTTGTCTGTAATGG 0: 1
1: 1
2: 0
3: 5
4: 56
1167672248_1167672259 19 Left 1167672248 19:50859939-50859961 CCTATCTCACTCTCTCCCTGCTT 0: 1
1: 0
2: 10
3: 155
4: 1809
Right 1167672259 19:50859981-50860003 GGGGGCCCACTTGTCTGTAATGG 0: 1
1: 1
2: 0
3: 5
4: 56
1167672251_1167672259 4 Left 1167672251 19:50859954-50859976 CCCTGCTTTTACCCTTAGGGTGA 0: 1
1: 0
2: 0
3: 27
4: 297
Right 1167672259 19:50859981-50860003 GGGGGCCCACTTGTCTGTAATGG 0: 1
1: 1
2: 0
3: 5
4: 56
1167672252_1167672259 3 Left 1167672252 19:50859955-50859977 CCTGCTTTTACCCTTAGGGTGAT 0: 1
1: 0
2: 2
3: 15
4: 147
Right 1167672259 19:50859981-50860003 GGGGGCCCACTTGTCTGTAATGG 0: 1
1: 1
2: 0
3: 5
4: 56
1167672258_1167672259 -8 Left 1167672258 19:50859966-50859988 CCTTAGGGTGATTCTGGGGGCCC 0: 1
1: 1
2: 7
3: 17
4: 179
Right 1167672259 19:50859981-50860003 GGGGGCCCACTTGTCTGTAATGG 0: 1
1: 1
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167672259 Original CRISPR GGGGGCCCACTTGTCTGTAA TGG Exonic
904834038 1:33323542-33323564 AGGGACCCACCTGTCTGTATGGG + Intergenic
915649698 1:157300805-157300827 TGGGGCCTACTTGAGTGTAAAGG + Intergenic
1070551922 10:77496640-77496662 GGGGGCCCACTGGTCTGACAGGG - Intronic
1077541437 11:3148317-3148339 GGGGGCCCACATGTCAGTGTTGG - Intronic
1079424969 11:20331532-20331554 GTGGGCCCAGTTTTCCGTAAAGG - Intergenic
1090767238 11:129886841-129886863 GGGGACCCACTTGGCTTTAGAGG - Intronic
1092056697 12:5513538-5513560 TGGGGCTCAGTTTTCTGTAAAGG + Intronic
1101032653 12:100675777-100675799 GGTGACCCACTTGTGTGAAATGG - Intergenic
1104150482 12:126077544-126077566 GGGGGCCCACTTTTAACTAAGGG - Intergenic
1105986435 13:25571991-25572013 AGCGGCCCACTTGTCTTTGAGGG + Intronic
1116631232 14:47336700-47336722 GGGGGCCTACTTTTCTTTGAGGG - Intronic
1127785388 15:62350855-62350877 GAGGGCCCACGTGACGGTAATGG + Intergenic
1128838796 15:70832762-70832784 GGGTCCCCACTTGGCTGTAGCGG + Exonic
1135939256 16:26806683-26806705 GGGGTCCCTCTTGTATGAAATGG + Intergenic
1138560213 16:57796955-57796977 GGTAGCCCAGTTGTCTGAAAGGG - Intronic
1143507977 17:7380084-7380106 AGGGGTCCAGATGTCTGTAAGGG - Intergenic
1144608743 17:16690198-16690220 GCAGGCGCACTGGTCTGTAACGG + Intergenic
1144904073 17:18625629-18625651 GCAGGCGCACTGGTCTGTAACGG - Intergenic
1145128514 17:20321113-20321135 GCAGGCGCACTAGTCTGTAACGG + Intergenic
1146825731 17:36021748-36021770 GCAGGCTCTCTTGTCTGTAAAGG + Intergenic
1157390818 18:47301931-47301953 GGGGCCCCACTCGTGTGTAGGGG + Intergenic
1158239885 18:55365330-55365352 TGGGTCCCACTTTTCTGTTAAGG + Intronic
1158623536 18:59052390-59052412 TAGGGCCCGCTTGTCTGTGATGG + Intergenic
1167119848 19:47510254-47510276 GAGGGCCAGCTTGTCTGTACAGG - Intronic
1167672259 19:50859981-50860003 GGGGGCCCACTTGTCTGTAATGG + Exonic
1167675011 19:50878413-50878435 GGGGGTCCACTTGTCTGTAATGG + Exonic
1167693968 19:51003229-51003251 GGGGGCCCCCTGGTTTGCAATGG - Exonic
933804587 2:85988974-85988996 GGGGGCCCAGGTGCCTGTGAGGG - Intergenic
937098911 2:119253826-119253848 GGGGGCCCAGATCTCTGTGAGGG + Intronic
937298536 2:120824380-120824402 GGGGGCCCACACCCCTGTAAGGG - Intronic
937457306 2:122053832-122053854 GGGGGCTCCCTTGTCTTTAAGGG + Intergenic
938597292 2:132800986-132801008 GTGGGCACACCTGACTGTAAAGG - Intronic
947772988 2:232685710-232685732 GTGGGCCCACTTGTCCAGAAAGG - Intergenic
1170672128 20:18444090-18444112 AGGAGCCAACTTGTCTGGAAAGG - Intronic
1173072835 20:39785988-39786010 GGGGGCCCACATGTCTGCCCAGG - Intergenic
1173413852 20:42838701-42838723 GGGTGCCCACTTCTCTGTGGAGG + Intronic
1179610420 21:42546631-42546653 GGCAGCCCACTTGTGTGCAAGGG - Intronic
1183488028 22:38099984-38100006 TGGTGCCCACTAGTCTGCAAGGG + Intronic
1183492991 22:38126666-38126688 GGGGGCCCACTGCTCTGGGAAGG + Intronic
952286185 3:31971873-31971895 GGGAGCAGACTTTTCTGTAAAGG - Intronic
953172979 3:40524681-40524703 GGGGGCCCACTTGTGCCTAGAGG + Intergenic
953635013 3:44655995-44656017 GGAGGCCCACGTGTCAGTGATGG + Intronic
954867099 3:53738992-53739014 GTGGGACCACTTCTGTGTAATGG - Intronic
963272133 3:143295912-143295934 GGGGGCCCTCATTTCTGAAAGGG - Intronic
963801385 3:149679461-149679483 GGGAGCCAACTTATCTGGAAAGG - Intronic
964329738 3:155589185-155589207 GAGGGCAAACTTTTCTGTAAAGG + Intronic
970341224 4:15108956-15108978 GTAGGCACACTTTTCTGTAAGGG - Intergenic
984780999 4:183525703-183525725 GGTGGCCCATGTGTCTGGAATGG - Intergenic
985516834 5:350643-350665 AGGGGCCCACCTGTCAGTGAAGG - Intronic
990362391 5:55033774-55033796 GGGGGCCCCTTGATCTGTAAAGG + Exonic
992529804 5:77643248-77643270 GGGCGGCCAAGTGTCTGTAAAGG + Intergenic
993833668 5:92789833-92789855 TGGGGCCTACTTGTGTGTGAAGG - Intergenic
1020769383 7:12369188-12369210 GAGGGCCCAGTTGTGTGTAAAGG + Intronic
1024295578 7:47839464-47839486 GGGAGCTCACCTGTCTGCAAGGG - Exonic
1028448232 7:90949909-90949931 GGGCGCCCAATTTTCTGGAAAGG + Intronic
1035742381 8:1938044-1938066 GGGCACCCACCTGTCTGTCAGGG + Intronic
1036221939 8:6928698-6928720 GCGCGCCCAGTTCTCTGTAAGGG - Intergenic
1039748754 8:40457443-40457465 TGCAGCCCACTTGTCTGTAAAGG + Intergenic
1043015942 8:74940642-74940664 GGGAGCCCACTTCCCTGAAAGGG - Intergenic
1044920598 8:97165884-97165906 GGGAGCCCTCTTGTCTGGAAAGG + Intergenic
1062713089 9:137987314-137987336 GGGGGCCCACTTCTCTACGACGG + Intronic
1187766948 X:22653155-22653177 GGGGGCTCTGTAGTCTGTAATGG - Intergenic
1199165062 X:144662540-144662562 TGGGGCCTACTTGCCTGTGAAGG - Intergenic