ID: 1167672262

View in Genome Browser
Species Human (GRCh38)
Location 19:50859993-50860015
Sequence GTCTGTAATGGTGTGCTTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167672258_1167672262 4 Left 1167672258 19:50859966-50859988 CCTTAGGGTGATTCTGGGGGCCC 0: 1
1: 1
2: 7
3: 17
4: 179
Right 1167672262 19:50859993-50860015 GTCTGTAATGGTGTGCTTCAAGG 0: 2
1: 0
2: 0
3: 7
4: 98
1167672252_1167672262 15 Left 1167672252 19:50859955-50859977 CCTGCTTTTACCCTTAGGGTGAT 0: 1
1: 0
2: 2
3: 15
4: 147
Right 1167672262 19:50859993-50860015 GTCTGTAATGGTGTGCTTCAAGG 0: 2
1: 0
2: 0
3: 7
4: 98
1167672257_1167672262 5 Left 1167672257 19:50859965-50859987 CCCTTAGGGTGATTCTGGGGGCC 0: 1
1: 1
2: 1
3: 15
4: 97
Right 1167672262 19:50859993-50860015 GTCTGTAATGGTGTGCTTCAAGG 0: 2
1: 0
2: 0
3: 7
4: 98
1167672251_1167672262 16 Left 1167672251 19:50859954-50859976 CCCTGCTTTTACCCTTAGGGTGA 0: 1
1: 0
2: 0
3: 27
4: 297
Right 1167672262 19:50859993-50860015 GTCTGTAATGGTGTGCTTCAAGG 0: 2
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167672262 Original CRISPR GTCTGTAATGGTGTGCTTCA AGG Exonic
900825564 1:4923958-4923980 TCTTGTAATGGTGTGCTTGATGG - Intergenic
906135140 1:43494064-43494086 GTCTGTACTTGTGCACTTCAGGG - Intergenic
906769450 1:48471511-48471533 GTCTGAAATGGTGTGCCTGCAGG + Intronic
907826297 1:58020460-58020482 TTGTGTAATGGAATGCTTCATGG + Intronic
920245240 1:204582890-204582912 GTCTGTAATGGTGTTTGACAGGG + Intergenic
920839694 1:209544385-209544407 GTCTGGGAGGGTGTGCTTAAGGG - Intergenic
922044946 1:221936435-221936457 AGCAGTAATGGTATGCTTCATGG + Intergenic
923415005 1:233748314-233748336 GTCTGAACTGGTGTGCTAGAGGG + Intergenic
924553042 1:245096148-245096170 GTCTGTCATGTTGTGCTTTGTGG - Intronic
1068066892 10:52143277-52143299 GTCAATAGTGGTGTGCTTCAGGG - Intronic
1073245967 10:102090415-102090437 GGCTTCAATGGGGTGCTTCAGGG + Intergenic
1074798637 10:116976261-116976283 GTCTGACATGGTGCTCTTCAGGG - Intronic
1075052537 10:119193509-119193531 TTCTTTCATGGTCTGCTTCAGGG - Intergenic
1075382404 10:122029934-122029956 GTGTGTGATTTTGTGCTTCAGGG + Intronic
1077203131 11:1323638-1323660 ATTTGTGAAGGTGTGCTTCATGG - Intergenic
1078687730 11:13548856-13548878 GTCTGCAGTGGTGTGCCTGAGGG + Intergenic
1086249629 11:84797894-84797916 CTCAGTAATGCTGTGCTTCCTGG + Intronic
1087539183 11:99493009-99493031 TTCTTTAATGGTTTGTTTCAGGG + Intronic
1088746534 11:112809007-112809029 CTCTGGAAGGGTGTTCTTCAAGG + Intergenic
1089448081 11:118569578-118569600 GTCTATAATGCAGTGCTTAAGGG + Intronic
1090310672 11:125734448-125734470 GTGTATATTGGTGTGCTTCATGG + Intergenic
1098045947 12:66400832-66400854 GTCTCTACTGCTTTGCTTCAGGG + Intronic
1103062788 12:117872511-117872533 GACTGCAGTGGTGTGATTCATGG - Intronic
1107864929 13:44694293-44694315 GTCTGTAAAGGTGAGCAGCAGGG - Intergenic
1110238268 13:73238706-73238728 TTCTCTAATGGTTTGGTTCAGGG + Intergenic
1111958826 13:94786835-94786857 ATCTTTAATGGTGAGTTTCATGG - Intergenic
1111981434 13:95019805-95019827 ATCTGTATTTCTGTGCTTCAAGG - Intergenic
1112776459 13:102849086-102849108 CTATGTAATAGTGAGCTTCATGG + Intronic
1112828775 13:103422922-103422944 GCCTATAATGGTGTGCTAGATGG - Intergenic
1123564437 15:21529177-21529199 GTGTGAAATGCTGTGATTCAAGG + Intergenic
1123600690 15:21966460-21966482 GTGTGAAATGCTGTGATTCAAGG + Intergenic
1127363689 15:58267370-58267392 GTCTGTCATTGTGTGTTGCAAGG - Intronic
1129699319 15:77758531-77758553 GGCAGTCAGGGTGTGCTTCATGG + Intronic
1130075698 15:80687551-80687573 GTCAGTGATAGTGTTCTTCAGGG + Intronic
1130246497 15:82254894-82254916 GTCAGTACTGATGTACTTCAAGG + Intronic
1141177795 16:81732181-81732203 GTGTGAAATGGTGTTCTTCTTGG + Intergenic
1144047012 17:11462995-11463017 GTATGTGATGCTGTGCTTCATGG - Intronic
1149472651 17:56931224-56931246 GACTGGAATGGTGTGCTTTAAGG + Intergenic
1152230979 17:79114035-79114057 GTCTCTCATGGTGAGCCTCAGGG - Intronic
1152253646 17:79225028-79225050 GTCTCTAATGGTGCGCCACAAGG - Intronic
1152394124 17:80021897-80021919 GTGTGTCATGGTGTGTGTCATGG - Intronic
1154080707 18:11253603-11253625 GTATATAATGGGGTGCTACAAGG + Intergenic
1156456448 18:37297280-37297302 GGCTCTAATGGTGGGATTCAAGG - Intronic
1165542286 19:36501998-36502020 GTGTGTATTGGTCTGCTTGATGG + Intergenic
1165652976 19:37507308-37507330 GTCAGTAATAGTGGTCTTCATGG + Intronic
1167665131 19:50819306-50819328 ATGTGTGATGGTGTGCTCCAAGG - Exonic
1167672262 19:50859993-50860015 GTCTGTAATGGTGTGCTTCAAGG + Exonic
1167675013 19:50878425-50878447 GTCTGTAATGGTGTGCTTCAAGG + Exonic
1168080671 19:54007981-54008003 TTCTGTAATGTTGGGCTGCATGG + Intronic
927601987 2:24451354-24451376 ATCTGGTAAGGTGTGCTTCAGGG + Intergenic
930813649 2:55569424-55569446 CCCTGTGATGCTGTGCTTCAGGG + Intronic
931167140 2:59760486-59760508 GGCTGTTATGGTGTTTTTCAAGG + Intergenic
935333625 2:101995585-101995607 GTCTGTGCTGGTGTGTTACACGG + Intronic
936150054 2:110012330-110012352 GGCTGTAATGGTGTGGATGAGGG - Intergenic
941500001 2:166262557-166262579 CTCTGTAATGGTGTAATTCAGGG - Intronic
941725416 2:168854822-168854844 TTCTTTAATGTTATGCTTCAAGG + Intronic
1169023828 20:2350502-2350524 GGCTGTAGTGCTGGGCTTCATGG - Intergenic
1172816690 20:37692804-37692826 TTCTGTAATTTTGTGCTTAATGG - Intergenic
1176065114 20:63190446-63190468 GTGGGCAATGGTGTGCTTCGGGG - Intergenic
950108686 3:10404733-10404755 GTCTCTATTGGTGTCATTCATGG - Intronic
950886820 3:16369541-16369563 GTCTCTAGTGGTTTGCTGCATGG - Intronic
951296944 3:20949048-20949070 TTTTGCAATGGTGTTCTTCAAGG + Intergenic
956698575 3:71939315-71939337 GTCTGCAATGCTGAGCTTCAGGG + Intergenic
956728979 3:72179165-72179187 ATGTTTGATGGTGTGCTTCAGGG - Intergenic
962848131 3:139288626-139288648 GTCTGTAATGCTGTGCTGTGGGG + Intronic
963847505 3:150174302-150174324 GACTGAAAGGGTGTGATTCAAGG - Intergenic
977979889 4:103308623-103308645 ATCTGTAAAGTTGTGATTCAAGG - Intergenic
979304862 4:119130807-119130829 GTTTGTGATGGTGTGGTACATGG + Intergenic
980826315 4:138077754-138077776 GTCTGTAATTATCTGCTACATGG - Intergenic
982122046 4:152152086-152152108 GTCCTTACTGGTGTGTTTCATGG + Intergenic
987097716 5:14565034-14565056 GTCTGGAAGGGAGGGCTTCAGGG - Intergenic
989262478 5:39433609-39433631 GTCTGTGATTGTGTGTTTCCTGG - Intronic
995364074 5:111335018-111335040 CTCTGCAATGATATGCTTCATGG - Intronic
998763812 5:145462059-145462081 GTCTATAGTAGTATGCTTCAGGG + Intergenic
1009697995 6:67134463-67134485 GCCTGTCCTGGCGTGCTTCATGG - Intergenic
1012566593 6:100663547-100663569 ATCACTAATGTTGTGCTTCAGGG - Intronic
1013817942 6:114121382-114121404 TTCTGTAATGCAGTGCATCAAGG + Intronic
1014183424 6:118408820-118408842 GTCTGTAATGGTGGTCAGCAGGG - Intergenic
1014287242 6:119514297-119514319 GTCTTTAATGTTATGATTCAGGG + Intergenic
1015071102 6:129093944-129093966 GTCTGTTCTGGTGTGCAGCAGGG - Intronic
1016989094 6:149917222-149917244 CCCTGTGATGCTGTGCTTCAGGG - Intronic
1017972808 6:159327799-159327821 GCCTGCAAGGCTGTGCTTCAGGG + Intergenic
1018407060 6:163497173-163497195 GTCTTTAGTGTTGTGCTTTAAGG + Intronic
1028388921 7:90292439-90292461 GACTGGAATGGTGTGCTTTGAGG - Intronic
1031091337 7:117359130-117359152 GTGTGTAATGGTATATTTCATGG + Intergenic
1033530002 7:142252327-142252349 ATCTGCAATGGGATGCTTCAAGG - Exonic
1033989865 7:147270243-147270265 ATCTGGAATGCTGTGTTTCAAGG - Intronic
1034752916 7:153587615-153587637 GTTTGTAATTATCTGCTTCATGG + Intergenic
1036094665 8:5710600-5710622 ATCTGCAATGGTGTTCTTCACGG + Intergenic
1037026023 8:14039305-14039327 CTGTGTAAAGGTGAGCTTCATGG - Intergenic
1038742489 8:30227594-30227616 TTCTGTGATGGTGAGTTTCAGGG - Intergenic
1040785821 8:51160762-51160784 ATTTTTAATGGTGTGCTTTATGG - Intergenic
1041956768 8:63565043-63565065 GTCTGTAATGCTATTGTTCATGG - Intergenic
1043870847 8:85430178-85430200 GTAAGTAATAGTGTGTTTCAAGG + Intronic
1048871542 8:138803275-138803297 GACAGTAATGGTGTGCTCCTGGG - Intronic
1050254065 9:3775792-3775814 GTTTTTACTGGTGAGCTTCATGG + Intergenic
1051415171 9:16832315-16832337 CTCTGGAATTCTGTGCTTCATGG - Intronic
1052015855 9:23465242-23465264 GCCTATAGTGGTGTGCTTAATGG - Intergenic
1057830737 9:98404636-98404658 GGCTGTACTGGTCTGCCTCAAGG + Intronic
1058954741 9:109935339-109935361 ATCTCTAATGGTGTGCCACAGGG - Intronic
1059220948 9:112618249-112618271 GTCAGCAAAGGTGAGCTTCATGG - Intronic
1059913708 9:119075501-119075523 GTTTCTAATGCTGTGCTTCTGGG - Intergenic
1187927809 X:24265995-24266017 GTCTTTTATGGTCTGCTTCCTGG + Intergenic
1188692796 X:33150900-33150922 CTCTGTTGTGGTTTGCTTCAGGG - Intronic
1189223728 X:39395456-39395478 CTGTGTAGTGGTGTGCCTCAGGG - Intergenic
1190375418 X:49784276-49784298 GTCTTGAATGCTGTGCTTAAAGG + Intergenic
1200834634 Y:7721325-7721347 GTCTCTAGTGGTTTGCTGCATGG - Intergenic