ID: 1167672265

View in Genome Browser
Species Human (GRCh38)
Location 19:50860008-50860030
Sequence CTTCAAGGTATCACGTCATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167672258_1167672265 19 Left 1167672258 19:50859966-50859988 CCTTAGGGTGATTCTGGGGGCCC 0: 1
1: 1
2: 7
3: 17
4: 179
Right 1167672265 19:50860008-50860030 CTTCAAGGTATCACGTCATGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
1167672261_1167672265 -2 Left 1167672261 19:50859987-50860009 CCACTTGTCTGTAATGGTGTGCT 0: 2
1: 0
2: 0
3: 10
4: 97
Right 1167672265 19:50860008-50860030 CTTCAAGGTATCACGTCATGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
1167672252_1167672265 30 Left 1167672252 19:50859955-50859977 CCTGCTTTTACCCTTAGGGTGAT 0: 1
1: 0
2: 2
3: 15
4: 147
Right 1167672265 19:50860008-50860030 CTTCAAGGTATCACGTCATGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
1167672257_1167672265 20 Left 1167672257 19:50859965-50859987 CCCTTAGGGTGATTCTGGGGGCC 0: 1
1: 1
2: 1
3: 15
4: 97
Right 1167672265 19:50860008-50860030 CTTCAAGGTATCACGTCATGGGG 0: 1
1: 1
2: 0
3: 3
4: 58
1167672260_1167672265 -1 Left 1167672260 19:50859986-50860008 CCCACTTGTCTGTAATGGTGTGC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1167672265 19:50860008-50860030 CTTCAAGGTATCACGTCATGGGG 0: 1
1: 1
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167672265 Original CRISPR CTTCAAGGTATCACGTCATG GGG Exonic
900733506 1:4279386-4279408 CATCAAGGTGTCACCTCATTTGG + Intergenic
903737559 1:25539855-25539877 CTTCAAGGTATCAGCAGATGGGG - Intergenic
913974805 1:143446700-143446722 CATCAAGGTCTCTCTTCATGTGG + Intergenic
914069196 1:144272316-144272338 CATCAAGGTCTCTCTTCATGTGG + Intergenic
914109959 1:144694038-144694060 CATCAAGGTCTCTCTTCATGTGG - Intergenic
923637692 1:235717416-235717438 CTTCAAGGAATGGTGTCATGTGG - Intronic
924601070 1:245489714-245489736 CGTCATGGTATCATGTGATGTGG + Intronic
1066201977 10:33150705-33150727 CTCCAAGGGATCTGGTCATGTGG + Intergenic
1068412043 10:56668860-56668882 CTTCAAGAGATGAAGTCATGAGG + Intergenic
1075840389 10:125497162-125497184 ACTGATGGTATCACGTCATGTGG + Intergenic
1080600295 11:33816170-33816192 CTGCAAAGTCTCAGGTCATGTGG - Intergenic
1084610492 11:70199494-70199516 ATGCAGGGTATCACGTGATGAGG + Intergenic
1091832622 12:3560737-3560759 CTTTAAGGTAGCATGACATGAGG + Intronic
1107266690 13:38564025-38564047 CTTCAAGATCTAATGTCATGAGG + Intergenic
1108802486 13:54116533-54116555 CTTCAAGCTAGCCAGTCATGGGG + Intergenic
1118602768 14:67482143-67482165 CTTCAAGGGAACAGGTGATGGGG + Intronic
1127841375 15:62835105-62835127 CTTCAAGGTATTTCCTCCTGTGG + Intronic
1137514809 16:49133868-49133890 ATCCAAGGTTCCACGTCATGTGG + Intergenic
1140809257 16:78561388-78561410 TTTCAAGGGCTCACGTGATGAGG + Intronic
1141074297 16:80989020-80989042 CTTCAGTGTATCACATCAAGAGG + Intronic
1145855657 17:28154463-28154485 CTTTAAGGTATTATTTCATGAGG - Intronic
1152229043 17:79105608-79105630 CTTCTAGGGATCACGTCAGGGGG + Intronic
1158406080 18:57160870-57160892 CTTCAAGATATCAAGTACTGAGG + Intergenic
1158895907 18:61912635-61912657 CTTCAAGGGAGCAAGTAATGAGG + Intergenic
1167665128 19:50819291-50819313 CTCCAAGGTGTCACATCATGGGG - Exonic
1167672265 19:50860008-50860030 CTTCAAGGTATCACGTCATGGGG + Exonic
1167675016 19:50878440-50878462 CTTCAAGGTATCACATCATGGGG + Exonic
927017847 2:18985273-18985295 CTTCAAGTTATCTTTTCATGTGG + Intergenic
934179504 2:89607668-89607690 CATCAAGGTCTCTCTTCATGTGG + Intergenic
934289796 2:91681936-91681958 CATCAAGGTCTCTCTTCATGTGG + Intergenic
938845494 2:135204500-135204522 CTTGAAGGAATCACTTGATGTGG + Intronic
939024747 2:136998557-136998579 CTTCACAGTATCAAGTTATGTGG + Intronic
940518200 2:154708426-154708448 CTTCAAACTATCACTTCATTGGG + Intronic
942390977 2:175492672-175492694 CTACAAAGTATCAAGCCATGTGG - Intergenic
1173370761 20:42432801-42432823 CTTCAGGATATCTCGTCATTTGG + Intronic
1173460257 20:43237558-43237580 GTGCAAGGCATCACATCATGAGG + Intergenic
1175820747 20:61907537-61907559 CTGCAAGGCATCATGGCATGGGG - Intronic
1177648674 21:23933254-23933276 CTTCAATGTTTCATGTCCTGGGG - Intergenic
951487240 3:23226947-23226969 CTTCATGGTATCACATCACCAGG - Intronic
951556265 3:23923542-23923564 CTGCATGGTATCCCATCATGTGG + Intronic
957113349 3:75993732-75993754 CTTCAATGTATTAAGTCAAGAGG - Intronic
968315854 3:197724661-197724683 CTTCATGGTATTCCATCATGTGG - Intronic
981233042 4:142380957-142380979 CTTCATTATATCACCTCATGTGG + Intronic
984473212 4:180203579-180203601 CTTCATGCTATGACCTCATGTGG - Intergenic
992035837 5:72775129-72775151 GTTCAAGGCATCACATGATGAGG - Intergenic
993258544 5:85626575-85626597 ATTCAAGTTATCATGTCATTGGG + Intergenic
1001066493 5:168538866-168538888 TTCCAAGGTATCATGTCATCAGG + Intergenic
1004469691 6:15918334-15918356 CTCCATGGTAACACGTCATATGG + Intergenic
1019495352 7:1336302-1336324 CTTCAATATCTCCCGTCATGGGG + Intergenic
1023175800 7:37434195-37434217 CCTCAAGGTACCACCTAATGAGG - Intronic
1026434445 7:70383102-70383124 CTGCAAGGTATCTCATCATTTGG + Intronic
1030495290 7:110291146-110291168 CTTCAAGGGGTCACCTCATGAGG + Intergenic
1032833870 7:135655402-135655424 CTTCAGTGTATCACATCAGGAGG + Intergenic
1033093289 7:138406545-138406567 CTTGAAGGTATCACTTCTTCAGG - Intergenic
1037549295 8:19954659-19954681 ATTCAAGGTATGACAACATGTGG - Intronic
1044378224 8:91501244-91501266 CTTCCAGGTATCACCTTTTGTGG - Intergenic
1049322633 8:142005010-142005032 CTGCAAGGTCACATGTCATGTGG + Intergenic
1053267633 9:36726598-36726620 CTTCAAGGCTTCACATAATGAGG - Intergenic
1058308640 9:103473366-103473388 CTTCAAGGTATCCCACCTTGTGG + Intergenic
1062564928 9:137160065-137160087 CTTCAAGGGACCATGGCATGGGG - Intronic
1192661214 X:73044812-73044834 CTTCCAGTTATAATGTCATGAGG - Intergenic
1194202329 X:90968361-90968383 CCTCATGGCATCACATCATGAGG - Intergenic
1200548165 Y:4543814-4543836 CCTCATGGCATCACATCATGAGG - Intergenic