ID: 1167675009

View in Genome Browser
Species Human (GRCh38)
Location 19:50878397-50878419
Sequence GACCCCCAGAATCACCCTAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167675009_1167675011 -7 Left 1167675009 19:50878397-50878419 CCCTTAGGGTGATTCTGGGGGTC 0: 1
1: 1
2: 2
3: 11
4: 101
Right 1167675011 19:50878413-50878435 GGGGGTCCACTTGTCTGTAATGG 0: 1
1: 1
2: 0
3: 1
4: 51
1167675009_1167675014 18 Left 1167675009 19:50878397-50878419 CCCTTAGGGTGATTCTGGGGGTC 0: 1
1: 1
2: 2
3: 11
4: 101
Right 1167675014 19:50878438-50878460 TGCTTCAAGGTATCACATCATGG 0: 1
1: 1
2: 1
3: 12
4: 137
1167675009_1167675013 5 Left 1167675009 19:50878397-50878419 CCCTTAGGGTGATTCTGGGGGTC 0: 1
1: 1
2: 2
3: 11
4: 101
Right 1167675013 19:50878425-50878447 GTCTGTAATGGTGTGCTTCAAGG 0: 2
1: 0
2: 0
3: 7
4: 98
1167675009_1167675015 19 Left 1167675009 19:50878397-50878419 CCCTTAGGGTGATTCTGGGGGTC 0: 1
1: 1
2: 2
3: 11
4: 101
Right 1167675015 19:50878439-50878461 GCTTCAAGGTATCACATCATGGG 0: 1
1: 1
2: 1
3: 6
4: 68
1167675009_1167675016 20 Left 1167675009 19:50878397-50878419 CCCTTAGGGTGATTCTGGGGGTC 0: 1
1: 1
2: 2
3: 11
4: 101
Right 1167675016 19:50878440-50878462 CTTCAAGGTATCACATCATGGGG 0: 1
1: 1
2: 1
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167675009 Original CRISPR GACCCCCAGAATCACCCTAA GGG (reversed) Exonic
905516512 1:38565795-38565817 GAACACTAGAATCACCCTCAGGG + Intergenic
907108318 1:51904139-51904161 AATCCTCAGAATCACCCTAAGGG + Intergenic
912858209 1:113190561-113190583 GGCCTCCAAAATCTCCCTAAGGG - Intergenic
912926519 1:113917990-113918012 GTCACCCAGCCTCACCCTAAAGG + Intergenic
914048448 1:144111227-144111249 GAACCCCAAACCCACCCTAAAGG + Intergenic
914130736 1:144854221-144854243 GAACCCCAAACCCACCCTAAAGG - Intergenic
920000183 1:202792404-202792426 GAACCCCAGAATGACTTTAATGG + Intronic
920055360 1:203186926-203186948 GCCCCCCATCATCACCCTAGTGG - Intergenic
924580191 1:245316838-245316860 GACCCTCACAATCACCTTCAAGG + Intronic
1065195478 10:23260999-23261021 GACCACCAGAATCACACTCGAGG + Intergenic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1070032825 10:72692962-72692984 GACCCCCAAAAGCACCTTTAAGG - Intronic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1078823416 11:14905369-14905391 GACTGCCAGAAGCACCCTCACGG - Intronic
1079260226 11:18871516-18871538 GACCTTCAGAGTCACCATAATGG + Intergenic
1083142475 11:60733433-60733455 GTGCCCCAGAATCACCCCAGGGG - Intronic
1083550889 11:63589552-63589574 GTCTCCCAGATTCACCCTTAGGG + Intronic
1083797777 11:65027586-65027608 GACCCCAGGACTCACCCCAAGGG + Exonic
1084153265 11:67301047-67301069 GACCCCCATCATCGACCTAATGG + Exonic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1088330511 11:108646108-108646130 GACGACCATAATCACCCAAATGG + Intergenic
1096155684 12:49340156-49340178 GATCCCCAGAATCCCCCCCAGGG + Intergenic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1099641086 12:85285398-85285420 GAGCCCCAGGAACACACTAAGGG - Intronic
1103982604 12:124746273-124746295 GAGACCCAGAATCAGCCTCAGGG + Intergenic
1113043527 13:106129211-106129233 GACCTCCATAATCAACCCAAAGG + Intergenic
1118710052 14:68511421-68511443 AGCTCCCAGAATCACCCTAGGGG + Intronic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1122139922 14:99656993-99657015 GACCTCCAGGATTATCCTAAAGG - Exonic
1123418381 15:20110822-20110844 GAACCCCAAACCCACCCTAAGGG + Intergenic
1123527599 15:21117362-21117384 GAACCCCAAACCCACCCTAAGGG + Intergenic
1132754117 16:1474495-1474517 GTCCCCCAGACTGGCCCTAAAGG - Intronic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1140201950 16:72902203-72902225 TGCTCCCAGAATCATCCTAACGG + Intronic
1141533867 16:84665652-84665674 GACCCAGAAACTCACCCTAAGGG + Intronic
1141813984 16:86396891-86396913 GACCCCCAGAACAATCCTCAGGG - Intergenic
1142608655 17:1096187-1096209 GACCCCCACAAGCACCCCAGAGG + Intronic
1146650493 17:34603318-34603340 GACCCCCAGAAGGAACCTGAGGG + Intronic
1147184055 17:38704267-38704289 GACCCCCAAAAACTTCCTAAAGG - Intergenic
1147916805 17:43892643-43892665 GACCCCCAGTATGAGGCTAATGG - Intronic
1148676732 17:49449966-49449988 GTCACCCAGAAACACCCTCACGG - Intronic
1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG + Exonic
1151718177 17:75842184-75842206 CACCCCCAGACTCACCCACAAGG + Intronic
1151980825 17:77507435-77507457 GAGCCCCAGATTCAACCCAAGGG + Intergenic
1157301834 18:46484945-46484967 GACCCCGAGAATCTCCCTCTTGG - Intronic
1162301961 19:9849404-9849426 GACCGCCAGATTCTCCCTTAAGG + Exonic
1166958959 19:46486599-46486621 GACACCCATACACACCCTAATGG + Intronic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167689695 19:50977676-50977698 GTCCCCCTGAGTCACCCTAGAGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
1202687901 1_KI270712v1_random:64125-64147 GAACCCCAAACCCACCCTAAAGG + Intergenic
925824820 2:7837418-7837440 GACCCTCTGAATCACCCTCGAGG + Intergenic
929549889 2:42883356-42883378 GAGTCCCAGAAGCCCCCTAAAGG + Intergenic
932844981 2:75125759-75125781 GACACCCAGGATCATCCTGAAGG + Intronic
933958450 2:87391462-87391484 GAACCCCAAACCCACCCTAAGGG - Intergenic
934242578 2:90283381-90283403 GAACCCCAAACCCACCCTAAGGG - Intergenic
934270598 2:91533297-91533319 GAACCCCAAACCCACCCTAAGGG + Intergenic
936997956 2:118435137-118435159 CACCCCAAGAATCACCCCAGTGG - Intergenic
945685741 2:212967327-212967349 GACCACCAGGGTCTCCCTAAGGG - Intergenic
948059776 2:235034181-235034203 GACCACAAGAATCACCCCTAAGG - Intronic
948141112 2:235671929-235671951 CACCCCCAGAATCCCCCTCAGGG - Intronic
1172651539 20:36506221-36506243 AATCCACAGAATCACCCTATTGG - Intronic
1174519749 20:51120342-51120364 GACACCCAGAACCAGCCTGATGG + Intergenic
1181350494 22:22253559-22253581 GAACCCCAAACCCACCCTAAGGG + Intergenic
1181893972 22:26090014-26090036 GAGGCCCAAAATCAGCCTAAAGG - Intergenic
1183383206 22:37500898-37500920 AACCCCCATAGTGACCCTAAGGG + Intronic
1184641854 22:45877067-45877089 GACCCCCAGAAGCTGCCTCAGGG - Intergenic
951832828 3:26949633-26949655 GCCCCCTAGAATCACCAGAAAGG + Intergenic
952147565 3:30549760-30549782 GAACACCAGAATTGCCCTAATGG + Intergenic
952223940 3:31354317-31354339 TAAACTCAGAATCACCCTAAAGG + Intergenic
953784578 3:45901435-45901457 GAACCCCAGAATGACCTTCAGGG - Exonic
960960633 3:123067883-123067905 GACTCTCAGAACCACCCTATGGG - Intronic
970873892 4:20847477-20847499 GAGCCTCAGAATCACCTGAAGGG - Intronic
974943459 4:68496636-68496658 GTCCTCCAGAGTCACCCTAAAGG - Exonic
983250211 4:165335506-165335528 GGCAGCCACAATCACCCTAAAGG - Intronic
985937741 5:3109709-3109731 GACCCCCAGATTCACCATGGAGG - Intergenic
998863148 5:146465652-146465674 GACCCCCAAAATGTCACTAATGG - Intronic
999341974 5:150780180-150780202 GACCCTCTGAATTACCCTAATGG + Intronic
1003019899 6:2500654-2500676 GCCCCCCTCAATCACCCCAATGG - Intergenic
1004644852 6:17550673-17550695 TACCCCCAAAATCTCCATAAGGG - Intronic
1005235662 6:23759437-23759459 GATCCCAAGAATTATCCTAAAGG + Intergenic
1005782031 6:29202153-29202175 GAACCACAGAACCACCCAAAAGG - Intergenic
1006556429 6:34871095-34871117 GAACTCCAGCATCACCCTAAAGG + Exonic
1006601348 6:35228539-35228561 CACCCCCAGACTCAGCCTTATGG - Intronic
1018278681 6:162161087-162161109 GAACCCAAGAAAGACCCTAAGGG - Intronic
1018445230 6:163852310-163852332 GACCCCCAGAATCACTATCTAGG - Intergenic
1019822658 7:3257041-3257063 GACCTCCATAAAAACCCTAAAGG - Intergenic
1021397959 7:20173455-20173477 GACCCTGACAATCACACTAAGGG - Intronic
1021945156 7:25719206-25719228 GACCCACAGAATTATCCTCAAGG + Intergenic
1022036814 7:26542517-26542539 GACCCCCAGAAAAAGCCTTAAGG + Intergenic
1029209851 7:98898081-98898103 GAAACCCAGAATCACCCTGCTGG + Intronic
1030523117 7:110622480-110622502 AACAGCCAGAATCACCCTTATGG - Intergenic
1031604954 7:123757663-123757685 GACCCCCAGAAACACCCCTGAGG + Intergenic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1034312331 7:150099731-150099753 GACCCAGAGATCCACCCTAAGGG - Intergenic
1034700025 7:153087801-153087823 GACCCCCAAAATCTCCCCCATGG - Intergenic
1034794522 7:154000927-154000949 GACCCAGAGATCCACCCTAAGGG + Intronic
1034903851 7:154926622-154926644 TACCCCTAGAAACTCCCTAATGG - Intergenic
1036149515 8:6284583-6284605 GATCACCAGACTCACCCTGAAGG - Intergenic
1048328283 8:133455142-133455164 GAAACCCACGATCACCCTAAGGG + Exonic
1048503436 8:134999370-134999392 GACCCACAGAATGACCAGAAAGG + Intergenic
1049070622 8:140352808-140352830 GAACAGCAGAATCACCCCAAAGG - Intronic
1050136686 9:2473046-2473068 GACTCCCAGAATCTCCCCAGTGG - Intergenic
1054905509 9:70411385-70411407 CACCCCCAGAGCCACACTAAAGG + Intronic
1061106902 9:128537977-128537999 TACTCCCAGATTCACCCTCATGG + Exonic
1190633087 X:52408041-52408063 GACCCACAGAATAAACTTAAGGG - Intergenic
1191902361 X:66054024-66054046 CACCATCAGAATCACCCTAGGGG + Intergenic
1194643637 X:96431695-96431717 TAACACCAGAATCACCCGAATGG + Intergenic
1195684436 X:107572756-107572778 GACACCCTGAATGACCCTGAAGG - Intronic
1200222380 X:154397570-154397592 GACCCCCAGACGCACCCGGAGGG + Intronic