ID: 1167675198

View in Genome Browser
Species Human (GRCh38)
Location 19:50879681-50879703
Sequence GAGTTCAAACAGATACAGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167675194_1167675198 -2 Left 1167675194 19:50879660-50879682 CCTCAGACCTGAGGTTCCCTAGA 0: 1
1: 0
2: 0
3: 13
4: 167
Right 1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG 0: 1
1: 1
2: 3
3: 29
4: 183
1167675193_1167675198 6 Left 1167675193 19:50879652-50879674 CCTGAAGTCCTCAGACCTGAGGT 0: 1
1: 0
2: 0
3: 13
4: 217
Right 1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG 0: 1
1: 1
2: 3
3: 29
4: 183
1167675195_1167675198 -9 Left 1167675195 19:50879667-50879689 CCTGAGGTTCCCTAGAGTTCAAA 0: 1
1: 0
2: 1
3: 12
4: 115
Right 1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG 0: 1
1: 1
2: 3
3: 29
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167675198 Original CRISPR GAGTTCAAACAGATACAGCA TGG Exonic
907999117 1:59663222-59663244 GAGGTCAAACAGCTAGAGTATGG + Intronic
909082200 1:71126214-71126236 GACTTCAAACAGACAAAGTAAGG - Intergenic
911377064 1:97063737-97063759 GAGTTGCAACAGAGACAGGAGGG - Intergenic
913121550 1:115745687-115745709 GACTTGAAACAGAAACAGAATGG + Intronic
914725335 1:150322438-150322460 GAGTTCACACAGAAACAGTTGGG - Intronic
914808192 1:151007137-151007159 GACTTAAAAATGATACAGCAAGG - Intronic
916146320 1:161743372-161743394 GAGGTCAAACTGATACAGCATGG + Intergenic
916899536 1:169205852-169205874 GAGGTCAAAGAGATACAGGATGG - Intronic
917015443 1:170526418-170526440 GGCATCAAACTGATACAGCATGG + Intergenic
920342451 1:205284162-205284184 GAGGTCAGACACATGCAGCAGGG - Intergenic
922679788 1:227583891-227583913 GAGATCAAACTAATACAGCATGG + Intronic
923066526 1:230522636-230522658 GACTTCAAACCGAAACAGCATGG - Intergenic
923296514 1:232599773-232599795 GACTGCAATCACATACAGCAAGG + Intergenic
923343230 1:233025176-233025198 GAGGTCAAACACCTGCAGCATGG + Exonic
924710173 1:246524727-246524749 GAGTTCCTACAGATACTGAAAGG - Intergenic
1063269772 10:4494987-4495009 GAGTTCAAACAGAAATTGCCTGG + Intergenic
1065706191 10:28473669-28473691 GAGTCCAAAAAGAGTCAGCAAGG + Intergenic
1066119092 10:32266440-32266462 GAAATCCAACAGATAGAGCAAGG - Intergenic
1066955381 10:42164843-42164865 GAGTACAAACAGATCCACAAAGG + Intergenic
1067073173 10:43152846-43152868 TAGTTAAAACAGATACCGCTAGG + Intronic
1067343335 10:45421299-45421321 GAGGTCAAACAGACCCAGCTGGG + Intronic
1071163745 10:82781052-82781074 CAGCACAAAGAGATACAGCATGG - Intronic
1073153747 10:101329975-101329997 GAGTACCTACAGATACCGCATGG + Intergenic
1074213489 10:111360735-111360757 GAGATCAATCAGTTAAAGCAGGG - Intergenic
1075703842 10:124486730-124486752 GAGTCCAAACTGATACAGCTGGG + Intronic
1078184943 11:9044125-9044147 GTCTTCAAACAAATACAGCCTGG + Intronic
1078544820 11:12239774-12239796 GAGTTGTAACAGAGACAGTATGG - Intronic
1080531699 11:33182555-33182577 GAGGTCAAACTGATATAGCATGG + Intergenic
1080742183 11:35076696-35076718 GAGTTGTGACAGATACTGCAGGG + Intergenic
1081027567 11:38034926-38034948 GAGTGAAAACAGAGACAGAAAGG + Intergenic
1085311832 11:75521368-75521390 CAATTCAAACAGATGCAGCTTGG + Intronic
1085499270 11:77004190-77004212 AAGGTCAAACTGATACAGCATGG + Intronic
1086250371 11:84805232-84805254 GAGTGTCAACAGAGACAGCATGG + Intronic
1086349704 11:85933293-85933315 GACTGCAAAAAGATACACCATGG + Intergenic
1087989122 11:104725893-104725915 CTGATCAAACAAATACAGCATGG - Intergenic
1089464663 11:118677136-118677158 GAGTTCAAACTGATACTGGGCGG - Intronic
1090582943 11:128179831-128179853 AAGTTAAAACAAAGACAGCAAGG - Intergenic
1091941708 12:4490453-4490475 GATTTCTCACAGATACAGCTAGG - Intronic
1093022267 12:14214805-14214827 GGGGTCAAACTGATTCAGCATGG + Intergenic
1094227198 12:28059203-28059225 AAGATCAAAAAGATACAGAAAGG - Intergenic
1094796632 12:33980760-33980782 GTTTTTAAGCAGATACAGCATGG - Intergenic
1095568704 12:43657080-43657102 GAGGTCAAACTGATAGAGAATGG - Intergenic
1096549323 12:52361782-52361804 GAGTTGAATCAGATACACCAGGG + Intronic
1097963548 12:65555860-65555882 AAGTTCTAACAGAGACAGCAAGG + Intergenic
1098167470 12:67713180-67713202 GTGTTTAAACAAAAACAGCAAGG + Intergenic
1100779506 12:98009120-98009142 CAGTTCACCCAGATGCAGCATGG + Intergenic
1102768553 12:115453206-115453228 GATGACAAACTGATACAGCAGGG + Intergenic
1106951727 13:34892048-34892070 GAGGTCAAACTGACACATCATGG - Intergenic
1107657913 13:42610662-42610684 GAGTTCAAACACACACAAAAGGG - Intergenic
1107991011 13:45819305-45819327 TACTTCTAACAGATACAGGATGG + Intronic
1108606993 13:52049554-52049576 GAATGCAAAGAGGTACAGCAGGG + Intronic
1110061860 13:71051269-71051291 GAGTAAAATCATATACAGCAAGG - Intergenic
1110500908 13:76226892-76226914 GAGTCCAGAAAAATACAGCAAGG + Intergenic
1112677909 13:101725125-101725147 GAGTGAAAAGAGATAAAGCACGG + Intronic
1113138568 13:107121015-107121037 GAGCTCCAACTGATACAGCTTGG - Intergenic
1113639896 13:111949742-111949764 GAGTCCAACCTGAAACAGCATGG + Intergenic
1114179771 14:20356365-20356387 CACTTCAAACAAATCCAGCAAGG - Exonic
1118145093 14:63126326-63126348 GAGATCAAACAAATCCAGCATGG - Intergenic
1119591657 14:75894187-75894209 GTGTTCAAACCAATAGAGCAGGG + Intronic
1120058307 14:79951483-79951505 GAACTCAAACAGACACAGCATGG + Intergenic
1121040971 14:90747096-90747118 GAGATCAGACTGATATAGCATGG - Intronic
1121413894 14:93765596-93765618 GAGGCCACACAGCTACAGCATGG + Intronic
1123394047 15:19909450-19909472 GAGTACAAACAGATCCACAAAGG - Intergenic
1123720712 15:23059404-23059426 GAGTTCAAACATGGACAACATGG + Intergenic
1124880421 15:33637259-33637281 GAGGTCAAACAGATACTCCTTGG - Intronic
1130753785 15:86741422-86741444 GAATTCAACCAGATGAAGCATGG + Intronic
1132356910 15:101178493-101178515 GACTTCAAAGAGATCCAGTACGG - Exonic
1135628676 16:24018397-24018419 GAGTTCAGTGAGATACTGCATGG - Intronic
1135720220 16:24811001-24811023 GAGGTCAGACAAATACAGGACGG + Intronic
1136186058 16:28589617-28589639 GACTTCACACAGAACCAGCATGG - Intronic
1136700060 16:32127356-32127378 GAGTACAAACAGATCCACAAAGG - Intergenic
1136767586 16:32800107-32800129 GAGTACAAACAGATCCACAAAGG + Intergenic
1136800563 16:33070591-33070613 GAGTACAAACAGATCCACAAAGG - Intergenic
1136868694 16:33780529-33780551 GAGTACAAACAGATCCATAAAGG - Intergenic
1136902935 16:34060899-34060921 GAGTACAAACAGATCCACAAAGG - Intergenic
1136958453 16:34814300-34814322 GAGTACAAACAGATCCACAAAGG - Intergenic
1137948608 16:52760201-52760223 GAGCTCAAATTGAAACAGCAGGG + Intergenic
1139045978 16:63060755-63060777 GAGTACAAACAGATACAAACTGG + Intergenic
1140912121 16:79463629-79463651 GACTTAAAACAGGTCCAGCAGGG - Intergenic
1203069981 16_KI270728v1_random:1062132-1062154 GAGTACAAACAGATCCACAAAGG + Intergenic
1203103482 16_KI270728v1_random:1335539-1335561 GAGTACAAACAGATCCATAAAGG + Intergenic
1145219464 17:21076293-21076315 GAAGTCAAAGAGATACAGCATGG - Intergenic
1145287774 17:21519251-21519273 AAAGTCAAACAGATACCGCATGG + Intergenic
1145710745 17:26972552-26972574 GAGTACAAACAGATCCACAACGG - Intergenic
1148656337 17:49286543-49286565 GACTTCAAACAAATACAATATGG - Intergenic
1151247444 17:72805689-72805711 GAGTGCAAACAGTGACAGCCAGG + Intronic
1151844466 17:76642574-76642596 GAGTTAAAAAAAATACAGAAAGG - Intronic
1203190114 17_KI270729v1_random:174926-174948 GAGTACAAACAGATCCACAAAGG - Intergenic
1154289040 18:13089695-13089717 TTGTTCAAACTCATACAGCAGGG - Intronic
1154517080 18:15182901-15182923 GAGTACAAACAGATCCACAAAGG + Intergenic
1156307401 18:35890516-35890538 GAGGTCAAACTGATACAGTGTGG - Intergenic
1157342259 18:46789900-46789922 GAGGTCAAACTGATACAGCATGG - Intergenic
1157817088 18:50737253-50737275 GAGGTCACACTGATACAGCATGG + Intergenic
1157910496 18:51613585-51613607 GAATTCAACGAGAAACAGCAGGG - Intergenic
1158438244 18:57449845-57449867 GAGTTCAGAAAGAAACAGAAAGG - Intronic
1162399444 19:10435947-10435969 GTCTTGAAACAGAAACAGCAGGG + Intronic
1167592347 19:50410862-50410884 GAGGTCAAACTGATACTGCATGG + Intronic
1167672424 19:50861059-50861081 GAGTTCAAGCAGATACAGCATGG + Intergenic
1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG + Exonic
1168392883 19:56025348-56025370 GAGGTCAAACAGATCCCGCCTGG - Intronic
1202668356 1_KI270709v1_random:21333-21355 GAGTACAAACAGATCCACAAAGG - Intergenic
928695675 2:33847575-33847597 GAAGTCAAACTGATACAGCGTGG - Intergenic
930395313 2:50815958-50815980 GAGAACACACAGACACAGCAAGG - Intronic
930827906 2:55712817-55712839 GAGGTCAAACTGATACAGTGTGG - Intergenic
930891497 2:56393548-56393570 GAGCTCAATCTGAGACAGCAAGG - Intergenic
932369482 2:71175522-71175544 GAAATCAAATTGATACAGCAAGG - Intergenic
933291515 2:80443313-80443335 TAATTCAAACTGACACAGCAAGG + Intronic
933391527 2:81674932-81674954 GAGTTTAAAGAGGGACAGCATGG + Intergenic
933441173 2:82316068-82316090 GAGTTCTAGGAGAAACAGCATGG - Intergenic
934711508 2:96517952-96517974 GAACTCAAACAGATACAGCAAGG + Intergenic
936530117 2:113270410-113270432 AAGTTCACACAAAAACAGCAAGG + Intronic
938517410 2:132027855-132027877 GAGTACAAACAGATCCACAAAGG + Intergenic
941106874 2:161364351-161364373 GAGTTTTAATAGACACAGCATGG + Intronic
941569117 2:167147459-167147481 GAGACCAAACTGATACAGCATGG - Intronic
942484432 2:176424306-176424328 GAGTTCAAAAAGATTCAGAATGG + Intergenic
943268008 2:185762245-185762267 AACTACAAACAGCTACAGCAAGG - Intronic
943802220 2:192075414-192075436 GAGTTTAAACAAAGACAACATGG + Intronic
946993749 2:225366787-225366809 GAGTTGTAACAGAGACAACAAGG + Intergenic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
1170025170 20:11881451-11881473 GAGATTCAACAGATACAGAAAGG + Intergenic
1176691349 21:9914312-9914334 TGGTTCAAATAAATACAGCATGG - Intergenic
1178137667 21:29646166-29646188 GAGATCAAATTGATACAGCATGG - Intronic
1181946884 22:26524972-26524994 GAGGTCAAAATGATACAGCATGG - Intergenic
1184810570 22:46828734-46828756 CAGTCCAAACAGAGACAGGAGGG - Intronic
1203288458 22_KI270735v1_random:8130-8152 GAGTACAAACAGATCCACAACGG + Intergenic
1203326287 22_KI270738v1_random:24035-24057 GAGTACAAACAGATCCACAAAGG + Intergenic
949946250 3:9192355-9192377 GGAATCAAACCGATACAGCATGG - Intronic
952767251 3:36964911-36964933 AAGTACAAACACATACAACATGG + Intergenic
954322500 3:49841690-49841712 GGGTTCAAACAAAGGCAGCATGG + Intronic
957436608 3:80185358-80185380 GAGTTCAATCAGTAACAACAGGG + Intergenic
957837176 3:85610257-85610279 GAATTCAAATAGTTACATCATGG - Intronic
959850462 3:111080948-111080970 GAGTTTAGACAGATAAAACAGGG + Intronic
964450833 3:156811222-156811244 GACTTCAAACTGAAACAGCAGGG - Intergenic
965711474 3:171560059-171560081 CAGTTCAACCAGATGCAGCAAGG + Intergenic
966345597 3:178975993-178976015 AAGTTCAAACCAATACAACAAGG + Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970825315 4:20265954-20265976 GAGTTCAAAGACATAAAGCTAGG - Intronic
970834927 4:20392204-20392226 GGCTTCAAACCCATACAGCATGG + Intronic
971804783 4:31341807-31341829 GAGTTCAAATAAATACAACCCGG - Intergenic
972192327 4:36610005-36610027 GAGTTCTGACAGGTCCAGCATGG + Intergenic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
975315202 4:72944204-72944226 GAGCTCAAGCAGATACCACATGG - Intergenic
976287901 4:83387699-83387721 GAGATTCAACAGATACAGAAAGG - Intergenic
976727068 4:88225125-88225147 AAGTTCAAAGAGTTACAGCAGGG + Intronic
977380894 4:96271961-96271983 AAGTTCAAATATATATAGCAGGG - Intergenic
979059248 4:116034765-116034787 GAGTTTAAACTGATACTGAATGG + Intergenic
979150806 4:117311701-117311723 TAGTTCAAACAGTTGCAGCAAGG + Intergenic
979703225 4:123690872-123690894 GAATACATACATATACAGCAAGG + Intergenic
983376883 4:166941123-166941145 CAGTTAAAACAGATTCAGGAGGG + Intronic
986723791 5:10579286-10579308 GAGTTCTAACATAGACAGGAAGG + Intronic
987915491 5:24207596-24207618 GAGGTCAAACTGATACAGAGTGG + Intergenic
988096150 5:26613198-26613220 GAGGTCTAACTGATGCAGCATGG - Intergenic
989951831 5:50308445-50308467 GACTTCAAACCAAAACAGCATGG - Intergenic
990047612 5:51453601-51453623 GAGTTGCAAAAGAGACAGCACGG - Intergenic
991004297 5:61812634-61812656 GAGTTCAAACACCTCCAGAAGGG - Intergenic
991150756 5:63365897-63365919 CAGTTCTAAGAGATACACCAAGG - Intergenic
991966240 5:72094299-72094321 CAGCCCAAACAGAAACAGCATGG - Intergenic
992351482 5:75933515-75933537 GACTTCAAAGAGAAACAGCCAGG - Intergenic
992803915 5:80318334-80318356 GACTACTCACAGATACAGCAGGG - Intergenic
993390218 5:87311778-87311800 GAGGTCAGACTGATACTGCATGG + Intronic
995440956 5:112191772-112191794 GAGTTCCAATGGATACATCACGG + Intronic
997180689 5:131825606-131825628 GAGGTCAAACAGACACAGTGTGG + Intronic
997834655 5:137182533-137182555 GAGTTCACATAGAGACAGCCTGG + Intronic
999019972 5:148154376-148154398 CACTGCAAACAGATACAGCAAGG - Intergenic
999746109 5:154593331-154593353 GAGTGCATACATATACAGCATGG - Intergenic
1000181953 5:158820242-158820264 GCCTTCAAACAGCTACCGCATGG - Intronic
1000735272 5:164891407-164891429 GGGTTCAAACTGATACTGCTTGG + Intergenic
1003139615 6:3459032-3459054 GCTTTCAAAGAGAAACAGCAAGG + Intergenic
1003724365 6:8743507-8743529 CAGTTCACACAGAGACAGCAAGG - Intergenic
1005134501 6:22552258-22552280 GAGTTAAAAGAGATAATGCAGGG - Intergenic
1005420103 6:25640153-25640175 GAATACAACCTGATACAGCAGGG + Intergenic
1010189167 6:73176795-73176817 GAGTTCAAGCAGTCACAGTAGGG + Intronic
1013571230 6:111428193-111428215 GACCTCAAACAGACAAAGCAAGG + Intronic
1015049911 6:128827788-128827810 GAATTCAAACAAACACAGTAGGG - Intergenic
1016646925 6:146420761-146420783 GAGTTCAAACAGAAAATGCAAGG - Intronic
1021281694 7:18727693-18727715 GAGGTAAAACAGAGGCAGCAGGG - Exonic
1021554140 7:21902829-21902851 CAATGCAAACAGATACAGAATGG + Intronic
1024807717 7:53165326-53165348 GAGTACAAACAGATCCACAAAGG + Intergenic
1025318863 7:58068732-58068754 GAGTACAAACAGATCCACAAAGG - Intergenic
1025482661 7:61002701-61002723 GAGTACAAACAGATCCACAAAGG - Intergenic
1025562777 7:62390530-62390552 GAGTACAAACAGATCCACAAAGG - Intergenic
1027462710 7:78475287-78475309 GAATGCAAACACATACACCATGG + Intronic
1027781772 7:82529036-82529058 AAGATAAAACAGATACTGCATGG - Intergenic
1028015412 7:85704912-85704934 GAGTCAAAAAAGAAACAGCATGG + Intergenic
1029347639 7:99990347-99990369 GACATCAATCAGATATAGCAAGG - Intergenic
1031606890 7:123779809-123779831 GAGTTCAAACTGATTCATCTTGG + Intergenic
1032886994 7:136151314-136151336 GAATACAGCCAGATACAGCAAGG - Intergenic
1033548035 7:142420397-142420419 GAGATCAAACAGATCCAGCCTGG - Intergenic
1034009413 7:147512096-147512118 GGGTGAAAACATATACAGCATGG + Intronic
1035852807 8:2938338-2938360 GATTTCATACAGATGCAGCCAGG + Exonic
1042965903 8:74351352-74351374 GAGTTCAAACGCATAAACCAAGG - Exonic
1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG + Intergenic
1044512422 8:93098033-93098055 GAGTACAAACAAAAACAGAAAGG - Intergenic
1044520351 8:93192381-93192403 GAGTGCAGACAGAGACATCATGG + Intergenic
1045645980 8:104299125-104299147 GACTTCAAAGAGATACAATAGGG - Intergenic
1047437123 8:124843965-124843987 TATATAAAACAGATACAGCAGGG + Intergenic
1050961451 9:11738511-11738533 GAGGTCAAACTGATACAGTGTGG - Intergenic
1052155028 9:25176153-25176175 GAGTTCTAACAAATAGAGGATGG + Intergenic
1053159272 9:35802255-35802277 GAGTTCAAACAGAACCTGCCGGG - Exonic
1053628281 9:39900382-39900404 TGGTTCAAATAAATACAGCATGG - Intergenic
1053777777 9:41565944-41565966 TGGTTCAAATAAATACAGCATGG + Intergenic
1054215606 9:62350319-62350341 TGGTTCAAATAAATACAGCATGG + Intergenic
1054364275 9:64316479-64316501 TGGTTCAAATAAATACAGCATGG - Intergenic
1054671875 9:67805032-67805054 TGGTTCAAATAAATACAGCATGG - Intergenic
1056179932 9:84072863-84072885 GAGGTCAAACGGATACAACGTGG - Intergenic
1058388282 9:104464020-104464042 CAGATCAAAGAGATACAGGAAGG + Intergenic
1185914839 X:4024378-4024400 GAGGTCAAACTAATACAGCATGG - Intergenic
1186683836 X:11903539-11903561 GACTTCAAACAAATAAAGCATGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1190934138 X:54979511-54979533 GATTTAAAACAAATAAAGCATGG + Intronic
1193699213 X:84742376-84742398 GACATCAAACAGAGACAGAAAGG + Intergenic
1196970553 X:121103634-121103656 GAGATAAATCAAATACAGCATGG - Intergenic
1197572435 X:128165779-128165801 GAGTACAAACAGAGACACCATGG + Intergenic
1198244034 X:134811883-134811905 GAGTTGCAACAGATACTGTATGG + Intronic
1199147348 X:144384056-144384078 TATTTGAAACATATACAGCAGGG - Intergenic
1199753981 X:150847592-150847614 GGGAGCAAGCAGATACAGCAAGG - Intronic
1200789934 Y:7290772-7290794 GAGCTCAAACAGCACCAGCAGGG - Intergenic