ID: 1167676868

View in Genome Browser
Species Human (GRCh38)
Location 19:50892725-50892747
Sequence ACTCCAGGTACAGAACCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167676868_1167676880 29 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676880 19:50892777-50892799 GTCTTGGAGAAGGAAAATGTTGG No data
1167676868_1167676875 7 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676875 19:50892755-50892777 GGCTGAAAGCCGGGAGTCCAAGG No data
1167676868_1167676881 30 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676881 19:50892778-50892800 TCTTGGAGAAGGAAAATGTTGGG No data
1167676868_1167676878 19 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676878 19:50892767-50892789 GGAGTCCAAGGTCTTGGAGAAGG No data
1167676868_1167676876 13 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676876 19:50892761-50892783 AAGCCGGGAGTCCAAGGTCTTGG No data
1167676868_1167676874 -2 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676874 19:50892746-50892768 GTTGGAGAAGGCTGAAAGCCGGG No data
1167676868_1167676873 -3 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676873 19:50892745-50892767 AGTTGGAGAAGGCTGAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167676868 Original CRISPR ACTCCAGGTACAGAACCCAT GGG (reversed) Intergenic
No off target data available for this crispr