ID: 1167676873

View in Genome Browser
Species Human (GRCh38)
Location 19:50892745-50892767
Sequence AGTTGGAGAAGGCTGAAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167676863_1167676873 24 Left 1167676863 19:50892698-50892720 CCTGAAAAACGTGGCTGGGAGTA No data
Right 1167676873 19:50892745-50892767 AGTTGGAGAAGGCTGAAAGCCGG No data
1167676868_1167676873 -3 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676873 19:50892745-50892767 AGTTGGAGAAGGCTGAAAGCCGG No data
1167676869_1167676873 -4 Left 1167676869 19:50892726-50892748 CCATGGGTTCTGTACCTGGAGTT No data
Right 1167676873 19:50892745-50892767 AGTTGGAGAAGGCTGAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167676873 Original CRISPR AGTTGGAGAAGGCTGAAAGC CGG Intergenic
No off target data available for this crispr