ID: 1167676874

View in Genome Browser
Species Human (GRCh38)
Location 19:50892746-50892768
Sequence GTTGGAGAAGGCTGAAAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167676868_1167676874 -2 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676874 19:50892746-50892768 GTTGGAGAAGGCTGAAAGCCGGG No data
1167676863_1167676874 25 Left 1167676863 19:50892698-50892720 CCTGAAAAACGTGGCTGGGAGTA No data
Right 1167676874 19:50892746-50892768 GTTGGAGAAGGCTGAAAGCCGGG No data
1167676869_1167676874 -3 Left 1167676869 19:50892726-50892748 CCATGGGTTCTGTACCTGGAGTT No data
Right 1167676874 19:50892746-50892768 GTTGGAGAAGGCTGAAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167676874 Original CRISPR GTTGGAGAAGGCTGAAAGCC GGG Intergenic
No off target data available for this crispr