ID: 1167676875

View in Genome Browser
Species Human (GRCh38)
Location 19:50892755-50892777
Sequence GGCTGAAAGCCGGGAGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167676869_1167676875 6 Left 1167676869 19:50892726-50892748 CCATGGGTTCTGTACCTGGAGTT No data
Right 1167676875 19:50892755-50892777 GGCTGAAAGCCGGGAGTCCAAGG No data
1167676868_1167676875 7 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676875 19:50892755-50892777 GGCTGAAAGCCGGGAGTCCAAGG No data
1167676872_1167676875 -8 Left 1167676872 19:50892740-50892762 CCTGGAGTTGGAGAAGGCTGAAA No data
Right 1167676875 19:50892755-50892777 GGCTGAAAGCCGGGAGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167676875 Original CRISPR GGCTGAAAGCCGGGAGTCCA AGG Intergenic
No off target data available for this crispr