ID: 1167676880

View in Genome Browser
Species Human (GRCh38)
Location 19:50892777-50892799
Sequence GTCTTGGAGAAGGAAAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167676872_1167676880 14 Left 1167676872 19:50892740-50892762 CCTGGAGTTGGAGAAGGCTGAAA No data
Right 1167676880 19:50892777-50892799 GTCTTGGAGAAGGAAAATGTTGG No data
1167676877_1167676880 -10 Left 1167676877 19:50892764-50892786 CCGGGAGTCCAAGGTCTTGGAGA No data
Right 1167676880 19:50892777-50892799 GTCTTGGAGAAGGAAAATGTTGG No data
1167676868_1167676880 29 Left 1167676868 19:50892725-50892747 CCCATGGGTTCTGTACCTGGAGT No data
Right 1167676880 19:50892777-50892799 GTCTTGGAGAAGGAAAATGTTGG No data
1167676869_1167676880 28 Left 1167676869 19:50892726-50892748 CCATGGGTTCTGTACCTGGAGTT No data
Right 1167676880 19:50892777-50892799 GTCTTGGAGAAGGAAAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167676880 Original CRISPR GTCTTGGAGAAGGAAAATGT TGG Intergenic
No off target data available for this crispr