ID: 1167681485

View in Genome Browser
Species Human (GRCh38)
Location 19:50924903-50924925
Sequence TATTGCCAGTGTCTATTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167681485_1167681488 21 Left 1167681485 19:50924903-50924925 CCAGAAAATAGACACTGGCAATA No data
Right 1167681488 19:50924947-50924969 AAATGCAATCAGAGAGATCTAGG No data
1167681485_1167681486 -4 Left 1167681485 19:50924903-50924925 CCAGAAAATAGACACTGGCAATA No data
Right 1167681486 19:50924922-50924944 AATACAGCAAATAAAGTCGAAGG No data
1167681485_1167681487 -3 Left 1167681485 19:50924903-50924925 CCAGAAAATAGACACTGGCAATA No data
Right 1167681487 19:50924923-50924945 ATACAGCAAATAAAGTCGAAGGG No data
1167681485_1167681489 24 Left 1167681485 19:50924903-50924925 CCAGAAAATAGACACTGGCAATA No data
Right 1167681489 19:50924950-50924972 TGCAATCAGAGAGATCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167681485 Original CRISPR TATTGCCAGTGTCTATTTTC TGG (reversed) Intergenic
No off target data available for this crispr