ID: 1167681488

View in Genome Browser
Species Human (GRCh38)
Location 19:50924947-50924969
Sequence AAATGCAATCAGAGAGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167681485_1167681488 21 Left 1167681485 19:50924903-50924925 CCAGAAAATAGACACTGGCAATA No data
Right 1167681488 19:50924947-50924969 AAATGCAATCAGAGAGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167681488 Original CRISPR AAATGCAATCAGAGAGATCT AGG Intergenic
No off target data available for this crispr