ID: 1167683948

View in Genome Browser
Species Human (GRCh38)
Location 19:50943771-50943793
Sequence GCCCCCCAGAATCACCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 2, 2: 2, 3: 25, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167683938_1167683948 20 Left 1167683938 19:50943728-50943750 CCCCAGGACACGAGTCCCTGCAG 0: 1
1: 0
2: 1
3: 19
4: 218
Right 1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 2
3: 25
4: 153
1167683946_1167683948 -7 Left 1167683946 19:50943755-50943777 CCATTGCAGACCACAGGCCCCCC 0: 1
1: 0
2: 5
3: 20
4: 238
Right 1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 2
3: 25
4: 153
1167683939_1167683948 19 Left 1167683939 19:50943729-50943751 CCCAGGACACGAGTCCCTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 2
3: 25
4: 153
1167683943_1167683948 5 Left 1167683943 19:50943743-50943765 CCCTGCAGGGAGCCATTGCAGAC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 2
3: 25
4: 153
1167683941_1167683948 18 Left 1167683941 19:50943730-50943752 CCAGGACACGAGTCCCTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 2
3: 25
4: 153
1167683944_1167683948 4 Left 1167683944 19:50943744-50943766 CCTGCAGGGAGCCATTGCAGACC 0: 1
1: 0
2: 0
3: 9
4: 186
Right 1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 2
3: 25
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167683948 Original CRISPR GCCCCCCAGAATCACCCTGC AGG Exonic
900868747 1:5287013-5287035 GTCCCCAAGATTCCCCCTGCTGG - Intergenic
901805567 1:11736425-11736447 GCCCCTCAGTGTCGCCCTGCTGG - Intronic
902612617 1:17606037-17606059 GCCCCCCAGCTTCACCCCACAGG - Intronic
903217840 1:21852888-21852910 GCCCCCCGGGACCACCTTGCTGG - Intronic
904256960 1:29260147-29260169 GCGCCCCAGCGACACCCTGCCGG - Intronic
904885137 1:33731920-33731942 TTCCCCCACAACCACCCTGCTGG - Intronic
905299612 1:36977661-36977683 CCTCCCCAGAATCAACCAGCTGG - Intronic
908868258 1:68576596-68576618 GTCCACCAGAAGCACCCTCCTGG - Intergenic
909608913 1:77532793-77532815 TGCCCCCAACATCACCCTGCTGG - Intronic
910216334 1:84848295-84848317 GAACCCCAGAATGCCCCTGCTGG + Intronic
917511781 1:175674809-175674831 GCCCCCCAGCATCAATCTGCTGG + Intronic
920055360 1:203186926-203186948 GCCCCCCATCATCACCCTAGTGG - Intergenic
920340768 1:205273895-205273917 GGCCACCTGAATCTCCCTGCTGG + Intergenic
922162729 1:223090240-223090262 GCCTCCCAGGCTCCCCCTGCTGG + Intergenic
922241085 1:223755868-223755890 GCCCCCCACAGCCAGCCTGCAGG + Intronic
923529200 1:234800189-234800211 GCCACCCAGAGTCCCCGTGCTGG - Intergenic
1065175019 10:23067688-23067710 GCCCTTTAGAATCACACTGCCGG - Intergenic
1069823455 10:71241342-71241364 GCCCCGCAGAAACATCCTACAGG + Intronic
1069915770 10:71785731-71785753 GCCCTCCAGTCTCACCCTCCTGG - Intronic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1074443965 10:113503132-113503154 GCCCCCCAAGATCACACAGCTGG + Intergenic
1075020599 10:118949299-118949321 GCTCCCCAGAGTCACTCAGCTGG + Intergenic
1076674957 10:132142844-132142866 CCACCCCAAAACCACCCTGCAGG + Intronic
1076729631 10:132431944-132431966 GCCCCCCAGGCTATCCCTGCTGG - Intergenic
1076764314 10:132624830-132624852 GCCCCACAGTGTCACCCTCCTGG + Intronic
1079085836 11:17444297-17444319 GCCCTGCAGCATCACCCTCCTGG + Intronic
1080713016 11:34769504-34769526 GCCCCCTAGACTCAAGCTGCTGG - Intergenic
1083818338 11:65150741-65150763 GTCAGCCAGAGTCACCCTGCTGG + Intergenic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1084510348 11:69599505-69599527 GCCCACCAGGCACACCCTGCAGG + Intergenic
1088481046 11:110296657-110296679 GCCCCCCCGCCTCCCCCTGCCGG + Exonic
1089560229 11:119339995-119340017 GCCCCCCAGATCTGCCCTGCGGG - Intronic
1091178717 11:133583893-133583915 CCCCCACAGAATCCTCCTGCAGG - Intergenic
1091537958 12:1430876-1430898 GCCCCTCAGCATCACTCTCCAGG - Intronic
1091980841 12:4862478-4862500 GCCTCCCAGAATCCTCCAGCTGG - Intergenic
1093490674 12:19700835-19700857 GTCCCCAAGAAGCACCCCGCTGG - Intronic
1094317573 12:29149716-29149738 GCCCCCCACATTAACCTTGCTGG - Intronic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1097020854 12:56020096-56020118 GCCCTCCCGAAGCACACTGCGGG + Intronic
1105426003 13:20295700-20295722 GCCCCCCAGGATGTCCCTGCCGG - Intergenic
1107727951 13:43318950-43318972 GCCCCACAGAGTCAACCTGGAGG + Intronic
1113363518 13:109653669-109653691 GCCCCCCAGAACAACCCAGGTGG - Intergenic
1113485041 13:110647035-110647057 GCCCACCAGCAGCACCCAGCAGG + Intronic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1119806271 14:77484490-77484512 GCTCCCCAGAACCCACCTGCAGG - Exonic
1119806352 14:77484844-77484866 GCTCCCCAGAACCCACCTGCAGG - Exonic
1120953034 14:90060458-90060480 GCCCTCCGGAATCACCCGCCCGG - Intergenic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1125120863 15:36157256-36157278 GCCTCCCAGACACACCCAGCAGG + Intergenic
1125827513 15:42688919-42688941 GGACCTCAGAATCACCTTGCTGG + Exonic
1128556334 15:68634327-68634349 GCCCCTGACAACCACCCTGCCGG - Intronic
1132475924 16:138226-138248 GCTCACCAGAATCACGCTGATGG + Exonic
1132704564 16:1237513-1237535 GCCCTCCCGAGTCACCCTGAGGG + Intergenic
1132706949 16:1248912-1248934 GCCCTCCCGAGTCACCCTGAGGG - Intergenic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1136107166 16:28038287-28038309 CCCCCCCCAAATAACCCTGCTGG + Intronic
1136247283 16:28983251-28983273 GGCTCCCAGCATCACCCAGCAGG - Exonic
1136517896 16:30778812-30778834 GCCCCTCAGAAACGCCCTGGTGG - Exonic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1141927270 16:87177858-87177880 ACCCCCCAGAATCCCCCTCCTGG - Intronic
1142810109 17:2392023-2392045 GCCACCCAGACTTATCCTGCAGG + Intronic
1142811823 17:2399154-2399176 GCCCCCCAGAATCCCCCGGCAGG - Intronic
1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG + Intronic
1144830502 17:18128424-18128446 CGCCCCCAGGATCACCTTGCTGG - Intronic
1146654481 17:34626896-34626918 GCCCCCCAGGAGGACCCTGCAGG + Exonic
1146787264 17:35731506-35731528 CCCCTCCAGACTCTCCCTGCGGG - Intronic
1149992600 17:61391250-61391272 GCCCCTCAGCATCAACCTGAAGG - Intronic
1150456213 17:65308855-65308877 GCCTCCCAGAAGCAGCCTGTGGG - Intergenic
1151242823 17:72771503-72771525 GCCCTCCAGGCTCACCTTGCAGG + Intronic
1151961679 17:77409007-77409029 GCCCCACAGAAAAATCCTGCAGG - Intronic
1152768221 17:82152328-82152350 ACACCCCACAACCACCCTGCAGG + Intronic
1153975381 18:10264182-10264204 TCCCACCAGAATCAGCCTGCGGG + Intergenic
1156354340 18:36328622-36328644 GCCACCCCTAATCACCCTACAGG - Intronic
1160571207 18:79818772-79818794 GCCCCCACGGAGCACCCTGCTGG - Intergenic
1160710672 19:549623-549645 GCCCGCCCGAGTCACCCTGCAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160824704 19:1074257-1074279 TCCCTCCAGACCCACCCTGCTGG - Intronic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1163383718 19:16986161-16986183 GCCCCCCAGTTCCCCCCTGCCGG + Intronic
1165807173 19:38587554-38587576 GCCCCCCAGCATCACTGTGTTGG + Intronic
1166059423 19:40316350-40316372 TCCACACAGAATCACTCTGCTGG + Intergenic
1166672949 19:44722463-44722485 GCCTCCCAGAATGTCCCGGCAGG + Intergenic
1167289342 19:48615827-48615849 TCTCCCCAGACTCAGCCTGCAGG - Intronic
1167647491 19:50713604-50713626 GCCCCCCAGATGCACCCACCTGG - Intronic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
928296331 2:30087223-30087245 GTCTCCCAGAATCCCCCAGCAGG + Intergenic
936045755 2:109186646-109186668 GCCCCCTAGGAAGACCCTGCGGG + Intronic
942468595 2:176235135-176235157 TTCCCCCAGAATCCTCCTGCAGG - Intergenic
943957656 2:194213451-194213473 GCACCTCAGAATCAACCTGCTGG - Intergenic
947017052 2:225632627-225632649 GCCTTCAAGAATCACCCTGTGGG - Intronic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
947854590 2:233314503-233314525 GCCCTCAAGATCCACCCTGCGGG - Intronic
947907242 2:233774314-233774336 GGCTCCCAGAGTCACCCAGCAGG - Intergenic
948093356 2:235314301-235314323 GCCCCCCACAATCACAGTGGGGG + Intergenic
949035609 2:241814574-241814596 GCCCCCCGGGCCCACCCTGCTGG + Exonic
1169162976 20:3398126-3398148 GGCCTCCAGGATCACCATGCAGG + Intronic
1171880431 20:30614494-30614516 TCTCCCCAGCCTCACCCTGCAGG - Intergenic
1172671052 20:36634685-36634707 GCCCTCCACAAGCACCCTGAGGG + Intronic
1172774946 20:37401846-37401868 GCTGCCCAGAATCACCCCTCAGG - Intronic
1173906343 20:46632408-46632430 GCCTCACAGAATCACCATGGTGG + Intronic
1174133892 20:48365518-48365540 GCCCCCCAGAAGCCCCTTCCAGG + Intergenic
1174484168 20:50851092-50851114 CCCCTGCAGAATCCCCCTGCAGG + Intronic
1175909267 20:62396908-62396930 GGCCCCAAGCAACACCCTGCTGG + Intronic
1176107524 20:63396396-63396418 GGCCCACAGCATCAACCTGCTGG - Intergenic
1179978868 21:44886202-44886224 AGCCCCCAGAAGCACCCGGCCGG + Exonic
1180748802 22:18110709-18110731 GCCCCCCGGCATCACAGTGCCGG - Intronic
1184188113 22:42877948-42877970 GCCACTCAGGATCACCCTGGTGG - Intronic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1185010202 22:48308713-48308735 GCTGCCCAGAGTCACCCAGCGGG + Intergenic
1185322227 22:50206877-50206899 CCCCCCCAGAAGCACCAGGCAGG - Intronic
950395979 3:12734486-12734508 ACCTCCCAGAATCTTCCTGCTGG + Exonic
950653743 3:14423960-14423982 TCTCCCCAGAATCATCCTGCAGG - Intronic
953352638 3:42227518-42227540 GCACACCAGAATCACCTTGAGGG - Intergenic
954698751 3:52441033-52441055 GGCCCCCAGCATCATTCTGCAGG + Exonic
955446737 3:59019507-59019529 GTCCCCCTAAATGACCCTGCAGG + Intronic
966729653 3:183140068-183140090 GTCCCCCAAAATCACATTGCTGG + Intronic
968452600 4:682275-682297 GCTCCCCAGACTCGGCCTGCAGG + Exonic
968972270 4:3802282-3802304 CTCACCCAGCATCACCCTGCAGG + Intergenic
969837799 4:9857673-9857695 TCCCCAGAGAATCACACTGCAGG + Intronic
970694405 4:18660052-18660074 GCCCCCAAAAGTCACCCTGCAGG - Intergenic
973982159 4:56315774-56315796 GCCCCCCAGCCTCCTCCTGCTGG + Exonic
974831291 4:67192827-67192849 GACCCCAAGAGTCACACTGCCGG + Intergenic
976745967 4:88403298-88403320 GCTCACCAGAATCACCCACCAGG + Intronic
985937741 5:3109709-3109731 GACCCCCAGATTCACCATGGAGG - Intergenic
991290380 5:65028265-65028287 GTGCTTCAGAATCACCCTGCAGG + Intergenic
992896457 5:81249477-81249499 GCCCCACAGTATCACCTAGCAGG - Intronic
994527949 5:100929899-100929921 GCCACCCAGACTCCTCCTGCAGG - Intergenic
997890516 5:137672298-137672320 GCCTCCCACAACCACCTTGCTGG + Intronic
1001556643 5:172641494-172641516 GCTCTCCAGAGTCACCCAGCGGG - Intronic
1002193073 5:177488960-177488982 ACCCCCCAGCATCAGCGTGCCGG - Intronic
1006257417 6:32842904-32842926 GCTCCCCAGATTCTGCCTGCTGG + Intronic
1006259082 6:32853495-32853517 GCCCCGCATATTCTCCCTGCTGG - Exonic
1006390239 6:33754171-33754193 GCCCCCCAGATATACCCAGCTGG + Intergenic
1006714064 6:36103050-36103072 GCCACCCAGGAGCTCCCTGCAGG + Intronic
1011101466 6:83727539-83727561 GCTCCTCAGGCTCACCCTGCAGG - Intergenic
1011416718 6:87129605-87129627 GGCCCCCAGAATCCCACTGTAGG + Intergenic
1015173715 6:130282835-130282857 CCCCAAGAGAATCACCCTGCTGG - Intronic
1017130245 6:151102469-151102491 GCCCCCCAGGCACATCCTGCAGG + Intergenic
1020081924 7:5290919-5290941 GCCTCCCAGAAACCCCCGGCGGG + Intronic
1021292702 7:18865583-18865605 GCCCCCCACAAGGACCCTACAGG + Intronic
1021600090 7:22356567-22356589 GGCCCCCAGATTCAGGCTGCGGG - Intronic
1025196991 7:56941219-56941241 GCCTCCCAGAAACCCCCGGCGGG - Intergenic
1025674957 7:63635718-63635740 GCCTCCCAGAAACCCCCGGCGGG + Intergenic
1026038243 7:66845168-66845190 GACCCACAGAAACACCGTGCTGG - Intergenic
1026850804 7:73722002-73722024 ACCCCACTGACTCACCCTGCAGG - Intergenic
1029209851 7:98898081-98898103 GAAACCCAGAATCACCCTGCTGG + Intronic
1029260185 7:99296910-99296932 TGCCCTCAGACTCACCCTGCAGG - Intergenic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1035444641 7:158932062-158932084 GCCTCCCAGAATCACGTGGCTGG + Intronic
1035544616 8:470143-470165 GCTCCACAGAATCACCCAGATGG + Intronic
1035575031 8:698928-698950 GCTCTCCAGGATCATCCTGCAGG + Intronic
1036634310 8:10538469-10538491 GCCCCCCACTGTCACCCTGTGGG - Exonic
1036695943 8:10975232-10975254 GCCACCCACACTCCCCCTGCCGG - Intronic
1037622519 8:20577306-20577328 GCCCTCCAGAAACTCCATGCTGG + Intergenic
1040105618 8:43539956-43539978 TCTCCCCAGCCTCACCCTGCAGG + Intergenic
1040391709 8:46955677-46955699 GCTCCCCAGAATCAGCATGCTGG + Intergenic
1040980470 8:53241712-53241734 GCTCTCCAGAATCACTCTCCTGG + Intronic
1044973862 8:97644649-97644671 GCCCACCAGGATCACCCAGCCGG - Exonic
1045378213 8:101597141-101597163 GCCCTCCAGATTCACTCTCCAGG - Intronic
1048204393 8:132403766-132403788 GGCACCCAGGCTCACCCTGCTGG + Intronic
1048863103 8:138738268-138738290 ACCCCACAACATCACCCTGCTGG - Intronic
1059746589 9:117207120-117207142 GCCCACCAGGAGCAGCCTGCAGG - Intronic
1060890947 9:127187959-127187981 GGCCCACAGAATCAACCTCCAGG + Intronic
1061584717 9:131558307-131558329 GGCCCCCAGATTCCCTCTGCAGG - Intergenic
1061808085 9:133147613-133147635 GTCCCCCAGAGGGACCCTGCCGG + Intronic
1062137176 9:134935374-134935396 GCTCCACGGAAGCACCCTGCTGG + Intergenic
1062386699 9:136314939-136314961 GAGGCCCAGAATGACCCTGCTGG - Intergenic
1186191716 X:7073159-7073181 GCCCCCCAGAAACCACCTTCAGG - Intronic
1189430023 X:40938059-40938081 GACCATCAGAATGACCCTGCTGG + Intergenic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1190279771 X:48922086-48922108 GGCCCCCAGACAGACCCTGCTGG + Intronic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1193635388 X:83943894-83943916 CACCCCCAGCATCACTCTGCTGG - Intergenic
1197697828 X:129569717-129569739 TCCACCCAGAATCTCCCTCCTGG - Intronic
1197749448 X:129954616-129954638 GGCGCCCAAAGTCACCCTGCTGG + Intergenic