ID: 1167684931

View in Genome Browser
Species Human (GRCh38)
Location 19:50950214-50950236
Sequence TCTGACATGCTGAGGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167684925_1167684931 -5 Left 1167684925 19:50950196-50950218 CCAGCTAGAGGGTGGGTGTCTGA 0: 1
1: 0
2: 1
3: 14
4: 136
Right 1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 221
1167684924_1167684931 0 Left 1167684924 19:50950191-50950213 CCAGACCAGCTAGAGGGTGGGTG 0: 1
1: 0
2: 0
3: 7
4: 165
Right 1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167684931 Original CRISPR TCTGACATGCTGAGGGGGCA GGG Intronic
903283472 1:22263247-22263269 CCTGACATGCCGAGGGGCCGTGG + Intergenic
904266060 1:29319167-29319189 TCTGGCCTGCTGAGGGGTCAGGG + Intronic
905973855 1:42161725-42161747 TCAGACAGGGTGAGGAGGCAGGG - Intergenic
906701734 1:47864714-47864736 GATGACATGCTGAGGGGCCTAGG + Intronic
907413383 1:54297877-54297899 CCTGTCTTCCTGAGGGGGCAGGG + Intronic
907421171 1:54348386-54348408 TGTGACTGGCTGAGGGGGCAAGG - Intronic
908007726 1:59743935-59743957 TGTGACATGCTGCCTGGGCAGGG - Intronic
908327052 1:63033100-63033122 TCTGCCATGAAGAGGGGGCCCGG + Intergenic
912651192 1:111441158-111441180 TCTCACAAGCTGAGAGGGCAGGG + Exonic
913086467 1:115441968-115441990 TCAGAGAGGCTGTGGGGGCAGGG + Intergenic
913176305 1:116276206-116276228 TTCTACATGCTGAGGGGTCAAGG - Intergenic
915011007 1:152686250-152686272 TCTGCCATACTGAGGAGGAATGG + Intronic
915099789 1:153491089-153491111 TCAAACATGCTGAGGGGTGATGG - Intergenic
915416220 1:155745377-155745399 TCTGAAGAGATGAGGGGGCATGG + Intergenic
915797903 1:158756144-158756166 TCTGACATGCTAGTGGGGCCGGG + Intergenic
915868162 1:159528183-159528205 CCTGACAAGCTAAGGTGGCATGG + Intergenic
916012722 1:160720549-160720571 TCCCACATGGTTAGGGGGCATGG - Intergenic
918396475 1:184118265-184118287 TCTGATATGCTGATGTGCCAGGG + Intergenic
920668731 1:207986504-207986526 TCTGAGACGCTGAGGGGTGAAGG - Intergenic
921669997 1:217914673-217914695 TCTGAGGTTCTGAGTGGGCATGG - Intergenic
921804130 1:219434948-219434970 TCTCCCATGATGAGGGGACATGG - Intergenic
921866575 1:220093565-220093587 TCTGATGAGCTGTGGGGGCAGGG - Intergenic
922725249 1:227920064-227920086 GCGGGCATGGTGAGGGGGCAGGG - Exonic
923268975 1:232337691-232337713 TGTGGCATTCTGAGGTGGCACGG - Intergenic
1063326228 10:5105834-5105856 TCTGGCAGGGTGAGTGGGCAGGG + Intronic
1066628765 10:37437581-37437603 TTTGGGATGCTGAGGTGGCACGG - Intergenic
1066658780 10:37720096-37720118 TCTGAGATGCAGAGGGGGCTGGG - Intergenic
1067054035 10:43040982-43041004 TCTGCCATGCTGTGGGGGGTTGG + Intergenic
1069800688 10:71079867-71079889 TCTGCCAGGCTGAGGGGAGAGGG - Intergenic
1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG + Intronic
1070372784 10:75801065-75801087 TCTGACATGGTGAAGGCGCTTGG - Intronic
1070412031 10:76150500-76150522 TCTGACATGTTAAGGGGCCAGGG - Intronic
1070603984 10:77885676-77885698 TTTGCCTTGCTCAGGGGGCAGGG - Intronic
1070655833 10:78270604-78270626 TCTGACATGCTGTGTAGCCACGG - Intergenic
1072559466 10:96557553-96557575 TCTTAAATGCAAAGGGGGCAGGG - Intronic
1072924405 10:99603977-99603999 TCTGTCATGCAGTGGTGGCATGG + Intergenic
1073424477 10:103447967-103447989 TCTGAAATGCTTGGAGGGCAAGG + Intronic
1075762307 10:124866033-124866055 TCAGACATGCTGGCGGGCCAAGG - Intergenic
1075906018 10:126082828-126082850 TCTTACAGTATGAGGGGGCAGGG + Intronic
1077138131 11:1011718-1011740 CCTGACATGCTGTGGAGGCAGGG + Exonic
1077445853 11:2590503-2590525 TCTCCCATGCTGGGAGGGCAAGG - Intronic
1077464840 11:2728797-2728819 TCTGGGGTGCTGAGGGGCCAAGG - Intronic
1077890067 11:6412106-6412128 TCTGAAAGGCTGAGGGGCCCAGG - Intronic
1078913793 11:15758671-15758693 TCTGACTTGGGGAGGGGGCGGGG - Intergenic
1083987063 11:66222439-66222461 TGTGATCTGCTGAGGGAGCAGGG - Intronic
1085299586 11:75450352-75450374 TGTGCCATGCTGAGGTGGCAGGG - Intronic
1085416298 11:76321270-76321292 TCTGAGACCCTGAGGGAGCAGGG + Intergenic
1085856440 11:80181414-80181436 TCTCACATGCTGGTGGGGTAAGG + Intergenic
1086943341 11:92820572-92820594 GCTCACATGGTGAGGGGTCAAGG + Intronic
1087266394 11:96066304-96066326 ACTGACATTCTGAGGGCACAAGG + Intronic
1088930058 11:114342258-114342280 TCTGACATGGGGTGGGGGGAAGG + Intergenic
1089659007 11:119973792-119973814 TCTGAGAGGCAGAGGGGGCCTGG + Intergenic
1089789550 11:120932816-120932838 GCTGGCATGTAGAGGGGGCAGGG + Intronic
1090138585 11:124227713-124227735 TCTTTAATGCTGAGAGGGCAGGG - Intergenic
1090310992 11:125739340-125739362 GCTGGCATGCTGAGGAGGAAAGG + Intergenic
1090364723 11:126196446-126196468 TTTCACATGCTGTGAGGGCACGG - Intergenic
1090722002 11:129483919-129483941 TCTGAGAGGCTGAGGTGGGAGGG - Intergenic
1092022458 12:5213879-5213901 TCTAATATGTTGCGGGGGCAGGG + Intergenic
1096516007 12:52155585-52155607 TCTGACAGGCTGGGGAGGAAGGG + Intergenic
1096821729 12:54241297-54241319 TCTGACATGTTGAGATGGAAAGG - Exonic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1100636133 12:96436330-96436352 GCTGACTTACTGAGGAGGCATGG - Intergenic
1102046445 12:109832955-109832977 TCCGACATGCTCAGGGGCCAAGG + Intronic
1102150470 12:110686371-110686393 AGTTACATGCTGAGGGTGCAAGG + Intronic
1102224442 12:111217944-111217966 TCTGACATGCTGTGGGCCCTGGG - Intronic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1103727290 12:123004462-123004484 TCTGAGATGCTGTGGCGGGAAGG + Exonic
1106958829 13:34973920-34973942 TCAGACATGCAGAGGGGCCCAGG - Intronic
1107845298 13:44506470-44506492 TGGGACCTGTTGAGGGGGCAGGG + Intronic
1112211336 13:97380597-97380619 TCTTACATGGTGAGGGGGACAGG + Intronic
1116569712 14:46499857-46499879 TCTGTCATGCTGAGGGGGAGGGG + Intergenic
1118476331 14:66120860-66120882 TCTGACAGGCATAGGGGGCCAGG + Intergenic
1119250418 14:73148172-73148194 TGAGAAATGCTGAGGGGGCTAGG + Intronic
1120942018 14:89957903-89957925 TCTGCCAGGCTGAGTGGGCAGGG - Intronic
1121960395 14:98254125-98254147 TCTACCAGGCTGAGGGGACAGGG + Intergenic
1124967813 15:34450265-34450287 TCTGTCTGGCTGAGGGAGCAGGG - Intergenic
1125542637 15:40479143-40479165 TCTGTCATTGTGAGGGGGCAAGG + Intergenic
1126779305 15:52125047-52125069 TCTGTCATGCAGAGAAGGCAGGG + Intronic
1127384658 15:58457543-58457565 TCTTACATGCTGAGGGGATGTGG - Intronic
1128612342 15:69084229-69084251 TCTGACATGGTGGGGGGAGAGGG - Intergenic
1128925309 15:71649961-71649983 TCTGACATCCAGAGGAGGGACGG + Intronic
1130953175 15:88608187-88608209 TCTGACTAGCTGAGTGAGCAGGG + Intergenic
1130978184 15:88793105-88793127 CTTGGCATGCAGAGGGGGCAGGG + Intergenic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132557936 16:580644-580666 TCTGACCTGGTGAGAGGGCCGGG + Intronic
1132715232 16:1286749-1286771 TCCCACAAGCTGAGGGGCCAGGG + Intergenic
1133171576 16:3985465-3985487 TCTGCCAAGGTGAGTGGGCATGG - Intronic
1133427395 16:5704667-5704689 TTTGACATTCTGAGGTGGCTAGG + Intergenic
1133502243 16:6377400-6377422 TCTGACATTCTGGGGGGCCATGG + Intronic
1133558820 16:6930885-6930907 TCGGCTATGGTGAGGGGGCAGGG - Intronic
1135186842 16:20322823-20322845 ACTACCATCCTGAGGGGGCAGGG - Intronic
1139750785 16:69107679-69107701 GCTTACATGCTGAAGGGGCGCGG - Exonic
1140252329 16:73305028-73305050 TCTGTCATTCTGCTGGGGCAAGG - Intergenic
1141638646 16:85328896-85328918 TCTGCCAGGCTGCGGGGGCAGGG - Intergenic
1141717461 16:85735082-85735104 TCTGCCCTGCAGAGGGAGCAGGG - Intronic
1142698028 17:1644208-1644230 TCAGAGATCCTGAGTGGGCAGGG + Intronic
1143150894 17:4807217-4807239 TCTGCCAGGGTGAGGGGGCCGGG + Exonic
1144347115 17:14359395-14359417 TGAGAGATGCTGAGGGTGCATGG - Intergenic
1147262855 17:39218803-39218825 TCTGAGAGGCTGAGGCGGGAGGG + Intronic
1147651873 17:42067507-42067529 TCTGTCATGCCCAGGGGGTACGG - Intergenic
1148688393 17:49513256-49513278 CCTGAGATGGTGACGGGGCAGGG - Exonic
1149522882 17:57331357-57331379 TCTGAGCTGGGGAGGGGGCAGGG + Intronic
1153939859 18:9968452-9968474 TAAGACAGGCTGAGGGGACACGG - Intergenic
1154145882 18:11865878-11865900 TCAGACATGCTGAGGGTGACTGG - Intronic
1157913337 18:51639782-51639804 TCCCACAAGCTTAGGGGGCAGGG - Intergenic
1159648973 18:70954787-70954809 TCTGCCATCCCGAGGGTGCATGG + Intergenic
1160135782 18:76270457-76270479 TCTGACATGCAGAGGGGCTTAGG - Intergenic
1162794947 19:13082123-13082145 TCACTCCTGCTGAGGGGGCAAGG - Intronic
1164465304 19:28482726-28482748 TTTGACACACTTAGGGGGCAAGG + Intergenic
1165064169 19:33219463-33219485 TCTGATTTGGGGAGGGGGCAGGG + Intronic
1165523600 19:36333216-36333238 TCAGCCATGCTGTGGGGGAAGGG + Intergenic
1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG + Intronic
1168243515 19:55098725-55098747 TCTGAGGAGCTGAGGGGACATGG + Intronic
925258992 2:2513160-2513182 ACTGCTATGCTGAGGGAGCACGG - Intergenic
928445821 2:31332628-31332650 TCTGGGATGCTGAGGTGGCCTGG + Intergenic
932749624 2:74363127-74363149 TGCAACATGCAGAGGGGGCAGGG + Exonic
933419553 2:82028690-82028712 TCTGACAAACTGGGGGTGCAGGG - Intergenic
933751502 2:85604864-85604886 TCTAACATGATGTGGGGGCAAGG + Intronic
933759620 2:85664767-85664789 TGGGAAAGGCTGAGGGGGCAGGG + Intronic
934935638 2:98463393-98463415 GCTGAAATGCTGGGAGGGCATGG - Intronic
935214571 2:100965899-100965921 TCTGAGATGATCTGGGGGCATGG + Intronic
936158773 2:110068798-110068820 TCTGACATGCCGAAGTGCCATGG - Intergenic
936185887 2:110302534-110302556 TCTGACATGCCGAAGTGCCATGG + Intergenic
936915500 2:117635619-117635641 TCTGGCATGCTGCGGGGCCCTGG - Intergenic
938289737 2:130142861-130142883 CCTGACATGCTGGGGGCCCAGGG - Intronic
939095825 2:137832094-137832116 TATGACATGTTGAGGGGAAAAGG - Intergenic
940894153 2:159064342-159064364 TTTTACATACTGAAGGGGCATGG - Intronic
946323984 2:218973517-218973539 TCTGAGATTCTGAGAGGCCAAGG - Intergenic
947430633 2:230024634-230024656 GCTGGCATGATGACGGGGCAAGG - Intergenic
1168912070 20:1456201-1456223 TCTGAAATGCTGAGGGGTCAAGG + Intronic
1169205745 20:3739640-3739662 TCTGAGGTGCTGGAGGGGCAGGG - Intronic
1171175687 20:23049665-23049687 TCTGACATGCGGATCGGCCAGGG + Exonic
1171184114 20:23112478-23112500 TCTGAGGTGCTGAGGTGACAAGG + Intergenic
1172125244 20:32621685-32621707 GCTCACATTCTCAGGGGGCAGGG + Intergenic
1172879593 20:38190920-38190942 TCTGACTTGCTGAGTGAGCCTGG - Intergenic
1173259635 20:41422175-41422197 ACTGCCATGCTGAGGAGCCAGGG - Intronic
1175036662 20:56005994-56006016 TCTGTGATGCTGTGGGGTCATGG + Intergenic
1175206370 20:57314837-57314859 GCTGACTTGCTGAGGGGTCCTGG + Intergenic
1177769775 21:25501555-25501577 ACTGACATGCTGAGGAGCCCAGG - Intergenic
1177815705 21:25974272-25974294 ACTTACATGATGAGGGGGCTGGG + Intronic
1179612361 21:42560482-42560504 CCTGACCTGCTGAGGGGCCTCGG - Intronic
1180078450 21:45475194-45475216 TCAGACATGCGGAGGCGGGAGGG - Intronic
1181310057 22:21939756-21939778 GCCCACATGCTGAGGGGTCACGG + Intronic
1181465730 22:23109672-23109694 TCTGAGATGCTGAGGGAGACAGG - Intronic
1181583608 22:23841383-23841405 TGTGAGATGCTCAAGGGGCAAGG + Intergenic
1184998276 22:48226436-48226458 CCTGCAATGCTGAGTGGGCATGG - Intergenic
1185375234 22:50479778-50479800 TTTGACCAGTTGAGGGGGCAGGG - Intergenic
949259767 3:2091698-2091720 TCTGCCGTGCTGAGCTGGCAGGG + Intergenic
950406494 3:12808317-12808339 TCTGACATGCTGAGCAGGTGTGG + Exonic
950704250 3:14770118-14770140 CCTGCCATTCTCAGGGGGCAGGG - Intronic
954789186 3:53118300-53118322 TCGGACCTGCTCTGGGGGCAGGG + Intronic
955433055 3:58870418-58870440 TAATACATGCTGAGGGGGGAGGG - Intronic
957432112 3:80124128-80124150 TATGACATTCTGTGGGTGCAGGG + Intergenic
959773891 3:110134169-110134191 TCTGTCATGCTGAGTCGGCATGG - Intergenic
963003012 3:140700812-140700834 TCTGACATGCAGAAGGGCCCAGG + Intronic
964157666 3:153605177-153605199 TTTGAGATGATGCGGGGGCATGG - Intergenic
965738606 3:171849114-171849136 GCTGCCATGCTTAGGGAGCAGGG - Intronic
965936257 3:174116626-174116648 TCTTACATGTTGGGCGGGCATGG - Intronic
966899392 3:184469440-184469462 TCTGACATGCAGAGGGTCCGGGG + Intronic
967020730 3:185520140-185520162 GCTGACATGGTGAGGGTGCTTGG + Intronic
967339383 3:188379277-188379299 AATGACATTCTGAGGGGGCTTGG + Intronic
969289614 4:6230329-6230351 TCTGACATGCCCATGGGCCATGG + Intergenic
969907829 4:10413747-10413769 TCTGACAAGCTGAAGAGGCTTGG - Intergenic
970360406 4:15303579-15303601 TGAGACAGGCTGAGGAGGCAGGG + Intergenic
970567053 4:17341757-17341779 TCTGACTTGGTGATTGGGCAGGG - Intergenic
972647485 4:40982861-40982883 TGTCACATGTTGAGGGGGAATGG - Intronic
974468814 4:62292778-62292800 TCTCCCATGCAGAGGAGGCAGGG - Intergenic
975639934 4:76490359-76490381 TCTGACATGCAGAAAAGGCAGGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
975878783 4:78876513-78876535 TCAGATATGCTGAAGGGGCTTGG + Intronic
977663716 4:99620720-99620742 TCTGACCTGCTGAGAGGACTGGG + Intronic
982361624 4:154524860-154524882 TCTCACAAGCTGAGGGAACAGGG - Intergenic
983973678 4:173905245-173905267 ACTTACTTGCTGAGGGGCCATGG - Intergenic
984664887 4:182415955-182415977 TATGGCATGCTGGGGAGGCAGGG - Intronic
984674766 4:182534202-182534224 TCTGACATGCTGAAGTAGCTGGG - Intronic
985553411 5:544452-544474 TCTCACACGCTGAGGGGCCGGGG + Intergenic
986469800 5:8062212-8062234 TCTGACATGATGAAGGGACTGGG + Intergenic
988880873 5:35500630-35500652 TATGACATTCTGAGTGGCCAGGG + Intergenic
989981034 5:50644638-50644660 TCTGATATACTGAGGTGGCAGGG - Intergenic
991776640 5:70091658-70091680 GCTGACACACTGAAGGGGCAAGG + Intergenic
991855927 5:70967105-70967127 GCTGACACACTGAAGGGGCAAGG + Intergenic
991869942 5:71099878-71099900 GCTGACACACTGAAGGGGCAAGG + Intergenic
992171651 5:74107821-74107843 GCTGAGATGGTGAGTGGGCAAGG + Intergenic
993277033 5:85873211-85873233 TCTGGCATGCTAATGGGCCATGG + Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
996684546 5:126266188-126266210 CCTGCCAGGCTGAGTGGGCAGGG + Intergenic
1006278177 6:33022714-33022736 TCTGAAAAGCTGTGCGGGCATGG + Intergenic
1010821318 6:80419141-80419163 TCTCACGTGCTGACAGGGCAAGG + Intergenic
1011413371 6:87090016-87090038 TCTGAAATGCTGAGGATGAAAGG - Intronic
1012872140 6:104685035-104685057 TCTGACAGGGTGAGGGAACAGGG - Intergenic
1013687560 6:112602324-112602346 TTTAAAATGCTGAAGGGGCAGGG + Intergenic
1014066675 6:117135038-117135060 TCTCACATTATGATGGGGCAGGG - Intergenic
1014332329 6:120085510-120085532 CCTGTCATGGGGAGGGGGCAGGG - Intergenic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1020211929 7:6164206-6164228 TCTGACAGCCTGACAGGGCAGGG + Exonic
1020275331 7:6620937-6620959 ACTGAAATGCTGCAGGGGCAGGG - Intronic
1021881953 7:25103620-25103642 GCTGACTTGCTGATGGGGCAAGG - Intergenic
1022478418 7:30727067-30727089 TCTGACTTGCTGAGTGGTGACGG - Intronic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1026614092 7:71886379-71886401 AGTGACATGCTAAGGGGGCGTGG - Intronic
1029433340 7:100546710-100546732 CCTGACATTCTGAAGGGGAAGGG + Intronic
1032482891 7:132261150-132261172 TCTGACATGCCCAGGGGACATGG + Intronic
1034418518 7:150977560-150977582 TGTGACACGCTGAGTGTGCAGGG - Intronic
1034490822 7:151392301-151392323 TCTGAGAGGCTGGGGGTGCAGGG - Intronic
1035516169 8:233860-233882 TCTGAAATCTTTAGGGGGCAGGG + Intronic
1039553985 8:38463853-38463875 ACTCACATGTTGAGAGGGCAGGG + Intronic
1043459774 8:80448163-80448185 TTTGACAGGCTGAGGTGGGAAGG + Intergenic
1045048382 8:98300858-98300880 CATGACCTGCTGATGGGGCAGGG + Intergenic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1046546004 8:115650922-115650944 GCTTGCATGCTGAGGGGGCAAGG - Intronic
1047070476 8:121337409-121337431 TTTGATAGGCTGAGGGAGCAAGG - Intergenic
1047374589 8:124283906-124283928 GCTGAGATGCTGAGATGGCAGGG + Intergenic
1047774517 8:128058791-128058813 TCTGTCATGCTGGGGGTGGAGGG - Intergenic
1050194385 9:3065663-3065685 TATGACATGTTAAGGGGGAAGGG - Intergenic
1050747661 9:8895671-8895693 TGTGACATGCTGAAGTGACATGG - Intronic
1052972557 9:34385892-34385914 TCTGACATGGGGAGGGGGGTTGG - Intronic
1053072714 9:35110679-35110701 CCCAACATGCTGAGGGAGCAAGG + Exonic
1053177976 9:35943125-35943147 TGTGACATGTGCAGGGGGCAGGG + Intergenic
1055451333 9:76433660-76433682 TTTGGCAGGCTGAGTGGGCAGGG + Intronic
1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG + Intronic
1058535043 9:105950218-105950240 TCAGACATGCTGGTGGGGTAGGG + Intergenic
1059468141 9:114482614-114482636 GCAGACATGCTGAGGGGGAGGGG - Intronic
1059682499 9:116599796-116599818 TCTGACATGGGGAGGTGGAAGGG - Intronic
1060557928 9:124518927-124518949 TCTGTCCTGCTGAGAGGCCAGGG + Exonic
1061648284 9:132024531-132024553 TCTGACATGCTTAGGGTGACAGG - Intronic
1062166885 9:135112433-135112455 TCTGACCTCATGAGGGGCCATGG - Intronic
1062391429 9:136335460-136335482 TCTGCCCTGCTGAGAGGTCAGGG - Intronic
1188349722 X:29113099-29113121 GTTGACATGCTGACTGGGCACGG - Intronic
1189982211 X:46522143-46522165 TCTGACAAGCAGAAGTGGCACGG + Intronic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1191155381 X:57267244-57267266 TCCTGCATGCTGAAGGGGCAAGG - Intergenic
1192201047 X:69066980-69067002 TTTGTCAGGCTGTGGGGGCAGGG + Intergenic
1192622578 X:72693838-72693860 TCTGCCATGCTGAGGTGGGGTGG + Intronic
1194769512 X:97884179-97884201 TATGACATGTTGATGTGGCAGGG + Intergenic
1196191139 X:112796006-112796028 TCTGAAATCCTGGTGGGGCAGGG - Intronic
1197717461 X:129719835-129719857 TAAGAAATGCTGAGGGGTCAGGG - Intergenic
1197746756 X:129936694-129936716 TTTGACAGGCTGAGGTGGCATGG + Intergenic
1198338388 X:135690292-135690314 TCTGCCATGGTGTGGGGGCGTGG + Intergenic
1199143394 X:144336352-144336374 TCTGATATGGAAAGGGGGCAAGG - Intergenic
1199943048 X:152642709-152642731 CCTGCCTTCCTGAGGGGGCAGGG + Intronic
1199992129 X:152993287-152993309 TTGGACTTGGTGAGGGGGCAGGG - Intronic
1202353830 Y:24024876-24024898 TCTGATATGCTAAGAAGGCATGG - Intergenic
1202516949 Y:25645236-25645258 TCTGATATGCTAAGAAGGCATGG + Intergenic