ID: 1167686379

View in Genome Browser
Species Human (GRCh38)
Location 19:50959301-50959323
Sequence GACCCCCAGAATCACCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 2, 2: 5, 3: 15, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167686373_1167686379 18 Left 1167686373 19:50959260-50959282 CCATGACACAAGGCCTCGGAGGT 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 5
3: 15
4: 166
1167686370_1167686379 20 Left 1167686370 19:50959258-50959280 CCCCATGACACAAGGCCTCGGAG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 5
3: 15
4: 166
1167686377_1167686379 -10 Left 1167686377 19:50959288-50959310 CCACATACCAGCGGACCCCCAGA 0: 1
1: 0
2: 1
3: 30
4: 242
Right 1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 5
3: 15
4: 166
1167686375_1167686379 5 Left 1167686375 19:50959273-50959295 CCTCGGAGGTGGTCTCCACATAC 0: 1
1: 0
2: 0
3: 7
4: 40
Right 1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 5
3: 15
4: 166
1167686371_1167686379 19 Left 1167686371 19:50959259-50959281 CCCATGACACAAGGCCTCGGAGG 0: 1
1: 0
2: 1
3: 9
4: 82
Right 1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 5
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167686379 Original CRISPR GACCCCCAGAATCACCCTGC AGG Exonic
900195528 1:1373809-1373831 GACCCCCAAGATCTACCTGCGGG - Exonic
900616440 1:3567684-3567706 GACCCAGAGCGTCACCCTGCAGG + Intronic
900868747 1:5287013-5287035 GTCCCCAAGATTCCCCCTGCTGG - Intergenic
900988250 1:6085811-6085833 GACCCTCAGGATAGCCCTGCCGG - Intronic
901720189 1:11191152-11191174 GACCCCAAGAACCTCCTTGCAGG - Intronic
903656189 1:24950050-24950072 GACCCCCAGAAATACAGTGCAGG - Intronic
904885137 1:33731920-33731942 TTCCCCCACAACCACCCTGCTGG - Intronic
905092082 1:35437696-35437718 GACCCCAAGAATGACCATCCAGG - Intronic
906315934 1:44786432-44786454 GACCCCCAGAGGCTCCCGGCGGG + Intronic
908868258 1:68576596-68576618 GTCCACCAGAAGCACCCTCCTGG - Intergenic
909608913 1:77532793-77532815 TGCCCCCAACATCACCCTGCTGG - Intronic
910216334 1:84848295-84848317 GAACCCCAGAATGCCCCTGCTGG + Intronic
917511781 1:175674809-175674831 GCCCCCCAGCATCAATCTGCTGG + Intronic
920340768 1:205273895-205273917 GGCCACCTGAATCTCCCTGCTGG + Intergenic
922717061 1:227883288-227883310 GACCCCCAGCCTGGCCCTGCAGG - Intergenic
924604551 1:245521597-245521619 GACCCCCAGGCTGACCCTGTTGG + Intronic
1064179054 10:13099608-13099630 GAGCCCAAGAAGCATCCTGCAGG + Intronic
1065195478 10:23260999-23261021 GACCACCAGAATCACACTCGAGG + Intergenic
1065537785 10:26731533-26731555 TACCCCTAAATTCACCCTGCAGG - Intronic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1074713187 10:116194351-116194373 GACCCCCACCCTCACCTTGCTGG + Intronic
1076883321 10:133250012-133250034 GAGCCCCAGCATCACACTTCGGG + Intergenic
1077602877 11:3585772-3585794 CACCTGCAGAATCTCCCTGCTGG - Intergenic
1080984999 11:37452284-37452306 CATTCCCAGAATCACCCAGCAGG + Intergenic
1081409874 11:42745446-42745468 GACCCACTGCATCATCCTGCGGG + Intergenic
1083329947 11:61892765-61892787 GACCCACCGAATAACCCTCCTGG - Intergenic
1083818338 11:65150741-65150763 GTCAGCCAGAGTCACCCTGCTGG + Intergenic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1084838322 11:71822966-71822988 AACCCTCATAATAACCCTGCTGG + Intergenic
1084957892 11:72701204-72701226 CACCCCCCTAATCACTCTGCCGG - Intronic
1086391369 11:86367687-86367709 GAACCTCAGAATCATCATGCTGG - Intergenic
1087203030 11:95365271-95365293 GACCCCCAAATTCACACTGTGGG + Intergenic
1088680458 11:112237193-112237215 CATCCCCATAACCACCCTGCTGG + Intronic
1092285851 12:7128968-7128990 CACCCCCAAACTCACCATGCGGG - Intergenic
1092430089 12:8401304-8401326 CACCTGCAGAATCTCCCTGCTGG - Intergenic
1093490674 12:19700835-19700857 GTCCCCAAGAAGCACCCCGCTGG - Intronic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1097181998 12:57177174-57177196 GACCCTCCGGACCACCCTGCTGG + Exonic
1100113326 12:91272103-91272125 GACACCCAGCATCATCCTTCAGG + Intergenic
1102602964 12:114046720-114046742 GAAACCCTGAATCACCCTGGAGG + Intergenic
1104595329 12:130116704-130116726 GACCCCCAGCTTCAGCCTCCTGG - Intergenic
1104747571 12:131219785-131219807 GACCCCGAGGGTCAGCCTGCTGG + Intergenic
1105426003 13:20295700-20295722 GCCCCCCAGGATGTCCCTGCCGG - Intergenic
1112341538 13:98556653-98556675 GAAGCCCAGAATCACCCACCTGG + Intronic
1113589149 13:111486083-111486105 GACCCCCAGACACCCCATGCCGG - Intergenic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1115157394 14:30356629-30356651 GACCTCCAGAATCACTCCGGAGG - Intergenic
1115523322 14:34254663-34254685 GACTCAAAGAATCACCCAGCAGG + Intronic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1125827513 15:42688919-42688941 GGACCTCAGAATCACCTTGCTGG + Exonic
1128215621 15:65932383-65932405 GACGCCCAGATTCACCCCTCAGG - Intronic
1131310268 15:91284230-91284252 GAACCCAGGAATGACCCTGCTGG - Intronic
1132279257 15:100598811-100598833 GATCCCCAGACACAACCTGCTGG + Intronic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1133366104 16:5211585-5211607 CACCTGCAGAATCTCCCTGCTGG + Intergenic
1133602378 16:7351991-7352013 GAGCCCACGAATCACTCTGCAGG - Intronic
1136003414 16:27313098-27313120 GAAACTCAGAATCACTCTGCAGG - Intergenic
1136092939 16:27933723-27933745 GAACCCCAGAACCTCCCTTCTGG + Intronic
1136247283 16:28983251-28983273 GGCTCCCAGCATCACCCAGCAGG - Exonic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140625765 16:76792973-76792995 TACCCTGAGAATGACCCTGCAGG + Intergenic
1141927270 16:87177858-87177880 ACCCCCCAGAATCCCCCTCCTGG - Intronic
1142811823 17:2399154-2399176 GCCCCCCAGAATCCCCCGGCAGG - Intronic
1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG + Intronic
1144830502 17:18128424-18128446 CGCCCCCAGGATCACCTTGCTGG - Intronic
1146650493 17:34603318-34603340 GACCCCCAGAAGGAACCTGAGGG + Intronic
1146654481 17:34626896-34626918 GCCCCCCAGGAGGACCCTGCAGG + Exonic
1147952645 17:44115634-44115656 GAACCCCAGGAACACTCTGCAGG + Intronic
1152564383 17:81093579-81093601 GACCCCCACGATGATCCTGCCGG - Intronic
1153975381 18:10264182-10264204 TCCCACCAGAATCAGCCTGCGGG + Intergenic
1157281283 18:46347832-46347854 GAGCCTCACTATCACCCTGCCGG - Intronic
1157301834 18:46484945-46484967 GACCCCGAGAATCTCCCTCTTGG - Intronic
1160225515 18:77008370-77008392 GACCCTCAGAAACTACCTGCGGG + Intronic
1160710672 19:549623-549645 GCCCGCCCGAGTCACCCTGCAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1161823425 19:6545562-6545584 GACACCCCGAAACACCCAGCTGG - Intergenic
1163626316 19:18391924-18391946 GACGCCCTGAGTCACCCAGCAGG + Exonic
1167136308 19:47618232-47618254 GACCCCTAGGATGACCCTGGAGG + Intronic
1167301465 19:48680326-48680348 CATCTTCAGAATCACCCTGCCGG + Intergenic
1167305021 19:48703271-48703293 CATCTTCAGAATCACCCTGCCGG + Exonic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
925824820 2:7837418-7837440 GACCCTCTGAATCACCCTCGAGG + Intergenic
928296331 2:30087223-30087245 GTCTCCCAGAATCCCCCAGCAGG + Intergenic
928388025 2:30885927-30885949 GAGCCCCAGAATTCCTCTGCTGG + Intergenic
932281517 2:70496941-70496963 TACTGCCAGAATCACCATGCAGG + Intronic
932844981 2:75125759-75125781 GACACCCAGGATCATCCTGAAGG + Intronic
933774949 2:85766263-85766285 GACCCCCAAAATCCCTCTCCAGG - Intronic
939829770 2:147057740-147057762 GACCCTCAGAATAACTCTGTAGG + Intergenic
942468595 2:176235135-176235157 TTCCCCCAGAATCCTCCTGCAGG - Intergenic
943957656 2:194213451-194213473 GCACCTCAGAATCAACCTGCTGG - Intergenic
947214705 2:227739523-227739545 GACCCCCACATTCTCACTGCCGG + Intergenic
947748881 2:232522798-232522820 GAGCCCCAGGAGCCCCCTGCCGG + Exonic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
947907242 2:233774314-233774336 GGCTCCCAGAGTCACCCAGCAGG - Intergenic
948141112 2:235671929-235671951 CACCCCCAGAATCCCCCTCAGGG - Intronic
1169162976 20:3398126-3398148 GGCCTCCAGGATCACCATGCAGG + Intronic
1170500141 20:16967087-16967109 TACCCCAAGCAGCACCCTGCTGG - Intergenic
1170570898 20:17632025-17632047 AACTCCCACAGTCACCCTGCAGG + Intronic
1174519749 20:51120342-51120364 GACACCCAGAACCAGCCTGATGG + Intergenic
1175722522 20:61295831-61295853 GACCCCAGGACACACCCTGCTGG - Intronic
1175909267 20:62396908-62396930 GGCCCCAAGCAACACCCTGCTGG + Intronic
1176107524 20:63396396-63396418 GGCCCACAGCATCAACCTGCTGG - Intergenic
1179261705 21:39763679-39763701 CATCCCCACACTCACCCTGCTGG + Intronic
1179426415 21:41282859-41282881 CACTCCCATGATCACCCTGCAGG + Intergenic
1179431809 21:41326681-41326703 GACCCCCACAATGGCCCCGCTGG + Intronic
1179978868 21:44886202-44886224 AGCCCCCAGAAGCACCCGGCCGG + Exonic
1180831197 22:18907020-18907042 TACCACCAGAGTCAGCCTGCCGG - Intronic
1183371320 22:37434044-37434066 CACCCCCAGCATCTCCCTGGAGG - Intergenic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1203281284 22_KI270734v1_random:132291-132313 TACCACCAGAGTCAGCCTGCCGG - Intergenic
950653743 3:14423960-14423982 TCTCCCCAGAATCATCCTGCAGG - Intronic
954387769 3:50253260-50253282 AACCCCCAGAAGGACACTGCTGG + Intronic
954457832 3:50609558-50609580 AAGCCCTAGTATCACCCTGCTGG - Intronic
954539323 3:51383234-51383256 AACCCCCAGAAAAACCCTGGAGG - Exonic
954698751 3:52441033-52441055 GGCCCCCAGCATCATTCTGCAGG + Exonic
954871911 3:53773874-53773896 CAACCCCAGATTCACCCAGCAGG + Intronic
955446737 3:59019507-59019529 GTCCCCCTAAATGACCCTGCAGG + Intronic
956212742 3:66818408-66818430 GAGCCACAGTATCCCCCTGCAGG + Intergenic
961280368 3:125761906-125761928 CACCTGCAGAATCTCCCTGCTGG + Intergenic
961642133 3:128371380-128371402 GATACCCACAAACACCCTGCAGG - Intronic
966729653 3:183140068-183140090 GTCCCCCAAAATCACATTGCTGG + Intronic
968972270 4:3802282-3802304 CTCACCCAGCATCACCCTGCAGG + Intergenic
969795835 4:9527743-9527765 CACCTGCAGAATCTCCCTGCTGG + Intergenic
970694405 4:18660052-18660074 GCCCCCAAAAGTCACCCTGCAGG - Intergenic
973924878 4:55727570-55727592 CACCCCCACTATGACCCTGCTGG + Intergenic
974831291 4:67192827-67192849 GACCCCAAGAGTCACACTGCCGG + Intergenic
982890068 4:160836032-160836054 GAACCTGAGACTCACCCTGCAGG + Intergenic
984869065 4:184310973-184310995 GACCCCCAGGAGCAGCGTGCTGG + Intergenic
985937741 5:3109709-3109731 GACCCCCAGATTCACCATGGAGG - Intergenic
986514737 5:8549349-8549371 GACCCCCACATCAACCCTGCAGG + Intergenic
988717281 5:33840736-33840758 GATCCCCAGGGCCACCCTGCAGG + Intronic
991290380 5:65028265-65028287 GTGCTTCAGAATCACCCTGCAGG + Intergenic
991648801 5:68830311-68830333 GACCCCCAAAAGGACCCAGCAGG + Intergenic
998256262 5:140591202-140591224 GACCCCCAGAACCTCCATGTGGG + Intronic
1005997117 6:30938291-30938313 GACCCCAGGAATCTACCTGCAGG - Intergenic
1006271319 6:32969118-32969140 AACCCCAAGAATCCCCCTCCCGG - Intronic
1006880145 6:37332139-37332161 GACACCCAGAACCAACCTGGAGG - Exonic
1007165221 6:39824297-39824319 GACCCCAAGATGCCCCCTGCTGG - Intronic
1011416718 6:87129605-87129627 GGCCCCCAGAATCCCACTGTAGG + Intergenic
1012958732 6:105599449-105599471 GACCCCCAAAATAATGCTGCTGG + Intergenic
1014896818 6:126911313-126911335 TACCCCCAAAATCACCTTGTTGG - Intergenic
1018445230 6:163852310-163852332 GACCCCCAGAATCACTATCTAGG - Intergenic
1021600090 7:22356567-22356589 GGCCCCCAGATTCAGGCTGCGGG - Intronic
1025747356 7:64255090-64255112 GACACCCAGAGTCCCCCTCCAGG - Intronic
1025990504 7:66493411-66493433 GACCCACAGAAACACTGTGCTGG + Intergenic
1026038243 7:66845168-66845190 GACCCACAGAAACACCGTGCTGG - Intergenic
1027213166 7:76166424-76166446 GACCCACAGAAACACTGTGCTGG + Intergenic
1029075801 7:97932958-97932980 CACCTGCAGAATCTCCCTGCTGG - Intergenic
1029209851 7:98898081-98898103 GAAACCCAGAATCACCCTGCTGG + Intronic
1029260185 7:99296910-99296932 TGCCCTCAGACTCACCCTGCAGG - Intergenic
1031020009 7:116617389-116617411 GACCCTCAGAACAACCCTGTAGG + Intergenic
1031604954 7:123757663-123757685 GACCCCCAGAAACACCCCTGAGG + Intergenic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1034447260 7:151120040-151120062 CACCCCCAGCATCAGCCAGCGGG + Exonic
1036149515 8:6284583-6284605 GATCACCAGACTCACCCTGAAGG - Intergenic
1036682398 8:10885203-10885225 GAAGCCCAAAATGACCCTGCGGG + Intergenic
1036831010 8:12019703-12019725 CACCTGCAGAATCTCCCTGCTGG - Intergenic
1038922724 8:32102745-32102767 GAAGCCCAGAAACACCCAGCTGG - Intronic
1040391709 8:46955677-46955699 GCTCCCCAGAATCAGCATGCTGG + Intergenic
1044973862 8:97644649-97644671 GCCCACCAGGATCACCCAGCCGG - Exonic
1047302325 8:123624235-123624257 GACCACCAGCACCAACCTGCTGG - Intergenic
1048204393 8:132403766-132403788 GGCACCCAGGCTCACCCTGCTGG + Intronic
1048511151 8:135064070-135064092 GACCTCCAGAAAAACCCTCCAGG + Intergenic
1049784026 8:144442022-144442044 CACCCCCAGGCTCACCATGCTGG + Exonic
1060890947 9:127187959-127187981 GGCCCACAGAATCAACCTCCAGG + Intronic
1061006128 9:127929334-127929356 GACCCCCACCCCCACCCTGCTGG - Intronic
1061584717 9:131558307-131558329 GGCCCCCAGATTCCCTCTGCAGG - Intergenic
1061808085 9:133147613-133147635 GTCCCCCAGAGGGACCCTGCCGG + Intronic
1062386699 9:136314939-136314961 GAGGCCCAGAATGACCCTGCTGG - Intergenic
1062392806 9:136340684-136340706 GACCCCCAGACTCCACCTCCGGG + Intronic
1062432197 9:136531232-136531254 GACCCCCACAACCGCCCTGGGGG + Intronic
1189430023 X:40938059-40938081 GACCATCAGAATGACCCTGCTGG + Intergenic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1190279771 X:48922086-48922108 GGCCCCCAGACAGACCCTGCTGG + Intronic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1193635388 X:83943894-83943916 CACCCCCAGCATCACTCTGCTGG - Intergenic
1195684436 X:107572756-107572778 GACACCCTGAATGACCCTGAAGG - Intronic
1197749448 X:129954616-129954638 GGCGCCCAAAGTCACCCTGCTGG + Intergenic
1200071234 X:153530481-153530503 AACCCACAGAAACACCCTGGAGG - Intronic
1200222380 X:154397570-154397592 GACCCCCAGACGCACCCGGAGGG + Intronic