ID: 1167687516

View in Genome Browser
Species Human (GRCh38)
Location 19:50965877-50965899
Sequence GGTTTCACTCAGCACCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167687512_1167687516 12 Left 1167687512 19:50965842-50965864 CCTTGTGGTGGGCATTCCAGGAA No data
Right 1167687516 19:50965877-50965899 GGTTTCACTCAGCACCTGATTGG No data
1167687515_1167687516 -4 Left 1167687515 19:50965858-50965880 CCAGGAAAGGTGTGTACATGGTT No data
Right 1167687516 19:50965877-50965899 GGTTTCACTCAGCACCTGATTGG No data
1167687511_1167687516 13 Left 1167687511 19:50965841-50965863 CCCTTGTGGTGGGCATTCCAGGA No data
Right 1167687516 19:50965877-50965899 GGTTTCACTCAGCACCTGATTGG No data
1167687509_1167687516 21 Left 1167687509 19:50965833-50965855 CCAAGAGTCCCTTGTGGTGGGCA No data
Right 1167687516 19:50965877-50965899 GGTTTCACTCAGCACCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167687516 Original CRISPR GGTTTCACTCAGCACCTGAT TGG Intronic