ID: 1167691136

View in Genome Browser
Species Human (GRCh38)
Location 19:50984088-50984110
Sequence CCCTCCCTCCGAAGGACGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167691127_1167691136 22 Left 1167691127 19:50984043-50984065 CCCTGACGCAGCGAGAGCAATTG 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1167691136 19:50984088-50984110 CCCTCCCTCCGAAGGACGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 92
1167691130_1167691136 -4 Left 1167691130 19:50984069-50984091 CCACTGCACTCTCTCTCCACCCT 0: 1
1: 0
2: 12
3: 147
4: 1212
Right 1167691136 19:50984088-50984110 CCCTCCCTCCGAAGGACGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 92
1167691128_1167691136 21 Left 1167691128 19:50984044-50984066 CCTGACGCAGCGAGAGCAATTGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1167691136 19:50984088-50984110 CCCTCCCTCCGAAGGACGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167691136 Original CRISPR CCCTCCCTCCGAAGGACGGG CGG Intronic