ID: 1167691752

View in Genome Browser
Species Human (GRCh38)
Location 19:50989258-50989280
Sequence CTGGAGACTCAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167691752_1167691759 -4 Left 1167691752 19:50989258-50989280 CCCTCCCCCTTCTGAGTCTCCAG No data
Right 1167691759 19:50989277-50989299 CCAGTGTCCATTATACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167691752 Original CRISPR CTGGAGACTCAGAAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr