ID: 1167693058

View in Genome Browser
Species Human (GRCh38)
Location 19:50999115-50999137
Sequence GCGAGGGGCTCTCTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167693049_1167693058 23 Left 1167693049 19:50999069-50999091 CCTTGACTCTCTTAGGTGAGTCC 0: 1
1: 0
2: 1
3: 11
4: 89
Right 1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG 0: 1
1: 0
2: 3
3: 12
4: 158
1167693051_1167693058 2 Left 1167693051 19:50999090-50999112 CCCAATGTTTTCACTGTGAAGGA 0: 1
1: 0
2: 3
3: 13
4: 221
Right 1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG 0: 1
1: 0
2: 3
3: 12
4: 158
1167693052_1167693058 1 Left 1167693052 19:50999091-50999113 CCAATGTTTTCACTGTGAAGGAA 0: 1
1: 1
2: 0
3: 31
4: 273
Right 1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG 0: 1
1: 0
2: 3
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167693058 Original CRISPR GCGAGGGGCTCTCTGGATTC TGG Intronic
900891028 1:5449785-5449807 GGGTGGGACTCTCTGGACTCAGG - Intergenic
902179676 1:14678385-14678407 GCGAGGGGCTCTCGGGCCTTTGG + Intronic
902764923 1:18607693-18607715 ACGAGGGGGGCTCTGGAGTCAGG - Intergenic
903226233 1:21895504-21895526 CAGAGGGGCTCTGTGGAATCGGG - Intronic
903353509 1:22732220-22732242 GGGTGGGGCTCTATGAATTCTGG + Intronic
904302575 1:29564234-29564256 GGGAGAGGCTTTCTGAATTCAGG - Intergenic
917542332 1:175926494-175926516 GCCAGGGGCTCTCTGGACTTTGG - Intergenic
921180767 1:212629708-212629730 GCAAGGGGCTCCCTGGAGCCTGG + Intergenic
1062925024 10:1309756-1309778 GGGAGGGGCTCTCTGGGGTGTGG + Intronic
1068864073 10:61876425-61876447 GAGTGGGGCTCTTTGGTTTCTGG - Intergenic
1070800255 10:79241091-79241113 GATAGTGGCTCTTTGGATTCTGG + Intronic
1071281277 10:84106297-84106319 GCCAGGGGCTCTCTGGCCTTTGG - Intergenic
1072325280 10:94292017-94292039 GGGAGGGGCTCTGTTCATTCTGG - Intronic
1074526361 10:114266667-114266689 GCCAGGAGCTCTGTGCATTCAGG - Intronic
1075088270 10:119428570-119428592 GGGAGGGGGCCTCTGGGTTCAGG - Intronic
1077311605 11:1891303-1891325 GCCAGAGGCTCTCTGGTTTGGGG + Intronic
1079138981 11:17795155-17795177 GAGAGGAGGGCTCTGGATTCTGG + Intronic
1083827310 11:65211021-65211043 GGGTGGGGGTGTCTGGATTCTGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1085036887 11:73306252-73306274 GTGAGGGACTCCCTGGATGCTGG + Intergenic
1089096958 11:115927377-115927399 GGGAGAGGGTCTCTGGAGTCTGG - Intergenic
1089458751 11:118640735-118640757 GGGAGGGGGTCTCTGGAAGCTGG + Intronic
1089771362 11:120805659-120805681 TGGAGGGGCACTCTGGCTTCAGG - Intronic
1090242337 11:125192902-125192924 GCGAGGGGCTGTTTGCATGCAGG + Intronic
1090742756 11:129680777-129680799 TGAAAGGGCTCTCTGGATTCTGG + Intergenic
1091398609 12:169600-169622 TTGAGGGTCTCTCTGGATTTGGG - Intronic
1091589604 12:1835516-1835538 GCGAGAGGCTCTGTGGTCTCAGG - Exonic
1092053701 12:5491669-5491691 GAGAGGGGTTCTCTGCACTCTGG - Intronic
1094834236 12:34314781-34314803 GCGTGGGGATCTGGGGATTCTGG - Intergenic
1095141685 12:38671640-38671662 GTAAGCGGCTCTCTGGAGTCTGG - Intronic
1096457113 12:51796750-51796772 GCCAGGGGCTCTCTGGCCTTTGG - Intronic
1096809529 12:54160642-54160664 GTGAAGGTCTCTCTGGATCCTGG + Intergenic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1097370784 12:58777906-58777928 ATAAGTGGCTCTCTGGATTCTGG - Intronic
1097614980 12:61872833-61872855 GGGTGGGTCTCTCTGGACTCTGG - Intronic
1100265011 12:92967279-92967301 GCCAGGGGCTCTCAGGCTTTCGG + Intergenic
1101713856 12:107293353-107293375 GCCAGGGGCTCTCAGGCTTTTGG + Intergenic
1102687460 12:114735828-114735850 GCGAGGGGCTGCCGGGATTCGGG + Intergenic
1103704092 12:122862128-122862150 GCGTGGGGCTCCCTGCCTTCTGG + Exonic
1103920438 12:124396637-124396659 GCGAGGGTCTCTCTGGGTCCAGG + Intronic
1104606898 12:130196216-130196238 GCGAGGGGCTGTGTGCATGCTGG + Intergenic
1105329482 13:19402198-19402220 GCGAGGGGCACTCTGGATACAGG + Intergenic
1108847939 13:54698172-54698194 GCTAGGGGCTGCCAGGATTCGGG - Intergenic
1109565109 13:64102942-64102964 GCCAGGGGCTCTCGGGTTTTTGG + Intergenic
1117194510 14:53326401-53326423 TAGAGAGGGTCTCTGGATTCAGG - Intergenic
1117222079 14:53616511-53616533 GCCAAGGGCTCTCTGGCTTTTGG - Intergenic
1121017467 14:90557182-90557204 GCGAGGGCCTCACTGTACTCAGG + Intronic
1122741116 14:103872087-103872109 AGGAGGGGCCCTCTGGACTCAGG - Intergenic
1123039754 14:105485678-105485700 GTGTGGGGCTCTCTGGAGTGTGG + Intergenic
1123184610 14:106504935-106504957 GCCAGGGGCTCTCTGGCCTTTGG + Intergenic
1124363232 15:29054034-29054056 GCGCGGGGCTCTCTGGCCGCAGG - Exonic
1124962585 15:34409797-34409819 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1124979210 15:34556019-34556041 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1126065505 15:44823131-44823153 GCCACTGGCTCTCTGGCTTCAGG - Intergenic
1126094329 15:45077460-45077482 GCCACTGGCTCTCTGGCTTCAGG + Intergenic
1126758835 15:51950460-51950482 GTGAGGAGCTCTCTGGGTTGAGG - Intronic
1128054298 15:64688374-64688396 GGGAGGGACTGTCTGGGTTCAGG - Exonic
1129166441 15:73780907-73780929 GAGAGGGGCTCTCTGCTTTGGGG - Intergenic
1129891030 15:79072011-79072033 GGGAGAGGCTTTCTGGATTCTGG + Intronic
1131936527 15:97511987-97512009 GAGTGGGGCTCTCTGTTTTCTGG - Intergenic
1131972223 15:97904197-97904219 GAGAAGAGCTCTCTGGTTTCTGG + Intergenic
1137543403 16:49380120-49380142 GCCAGGGGCTCTCGGGCTTTTGG + Intronic
1138058712 16:53864395-53864417 GCAAGGGGATCTCAGGATGCAGG + Intronic
1139587980 16:67916596-67916618 GGGAGGAGCCCTCTGGGTTCTGG + Intronic
1139675337 16:68519585-68519607 ACTAGTGGCTCCCTGGATTCCGG + Intergenic
1143623639 17:8095688-8095710 GTGAGGGAATGTCTGGATTCAGG - Intergenic
1144779052 17:17798808-17798830 GGGAGGGGCCCAGTGGATTCTGG - Intronic
1146676571 17:34777370-34777392 GCCAGGGGCTGACTGGACTCTGG - Intergenic
1149656263 17:58310987-58311009 GCAAGGGGCGCTCTGGCCTCTGG + Exonic
1151162209 17:72175351-72175373 TCAAAGGTCTCTCTGGATTCTGG - Intergenic
1159058807 18:63493260-63493282 GAGGGGGGGCCTCTGGATTCTGG - Intronic
1160864273 19:1250206-1250228 GCGAGAGGCTCCCCGGATGCCGG - Exonic
1161320119 19:3637225-3637247 GAGAGGGGCTCGCTGGGGTCTGG + Intronic
1162335678 19:10058820-10058842 GCCACGGGCTCTCTCGATGCTGG - Intergenic
1165774224 19:38395513-38395535 GCCAGGGGCTCTGAGGGTTCCGG - Exonic
1165913384 19:39243751-39243773 GTCAGGGGCTGTCTGGGTTCTGG + Intronic
1165917571 19:39269872-39269894 GTCAGGGGCTGTCTGGGTTCTGG - Intronic
1166336404 19:42110657-42110679 GTGAGGGGCAGTCAGGATTCTGG - Intronic
1167594209 19:50418748-50418770 GCCAGGGGCTGTCTGGATTTGGG - Intronic
1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG + Intronic
926577781 2:14601231-14601253 GCCAGGGGCTCTCTGGCCTTCGG + Intergenic
928113071 2:28525966-28525988 GAGAGGGGCACTCTGAAATCTGG - Intronic
929313468 2:40451554-40451576 GCGCTGGGCTCTGAGGATTCAGG - Intronic
931777309 2:65551736-65551758 GGGAGGGACGCTCTGGATTCAGG - Intergenic
945243363 2:207696953-207696975 GCCAGGGGCTCTCGGGCTTTCGG - Intergenic
946280973 2:218665204-218665226 ACGAGGGGCTCTCTGCACACTGG + Exonic
946373350 2:219293996-219294018 GTGGGAGGATCTCTGGATTCTGG - Intronic
947231080 2:227887028-227887050 GAGAGGGGCTCTCTTAATCCTGG + Intronic
948003794 2:234590827-234590849 GGGCGGGGCTCTCTAGATTCGGG - Intergenic
948112922 2:235471470-235471492 GCCAGGGGCTCTCTGTTTTGAGG + Intergenic
1173464719 20:43271752-43271774 GTGAGGGGCTCGCAGGTTTCAGG + Intergenic
1174956095 20:55100295-55100317 GCCAGGGGCTCTCAGGACTTTGG - Intergenic
1175895697 20:62334704-62334726 GCCTGGGGCTCTCTGGATGATGG + Intronic
1179543272 21:42098211-42098233 TCGTGGGGCTCTCTGGGATCCGG - Intronic
1180248020 21:46561466-46561488 GCCAGGGGCTTGCTGGGTTCAGG + Intronic
1180565432 22:16659857-16659879 GCGAGGGGCACTCTGGATACAGG - Intergenic
1180842211 22:18964718-18964740 GCGAGGGGCTCCCAGGAGGCCGG - Intergenic
1181048693 22:20228607-20228629 GCTATGGGATCTCTGGCTTCTGG + Intergenic
1181059288 22:20274163-20274185 GCGAGGGGCTCCCAGGAGGCCGG + Intronic
1181622577 22:24101083-24101105 GCATGGGGCTTTCTGGATCCTGG + Intronic
1182604947 22:31496108-31496130 GCGTGGGCCTCTCTGGCTTTTGG - Intronic
1183162029 22:36120905-36120927 GCCAGGGGCTCTCAGGCCTCCGG - Intergenic
1184247950 22:43245136-43245158 CCGAGGGGCCCTCTGAACTCCGG + Intronic
1184467590 22:44677921-44677943 GCCAGGGCCTCTCTGGAAACTGG - Intronic
1185333106 22:50260438-50260460 GCCAGGGGTGCTCTGGTTTCTGG - Intronic
950036409 3:9889108-9889130 GCCAAGTGCTCTCTGGATTTGGG + Intergenic
951522362 3:23621578-23621600 GCTAGGGACCCTCTGGTTTCTGG + Intergenic
952925851 3:38318683-38318705 GTGAGGAGCTCTCTGGATGGGGG + Intergenic
956142890 3:66163450-66163472 GCTAGGGGCTGTCTGGACTCTGG + Intronic
956906701 3:73773404-73773426 GGATGGAGCTCTCTGGATTCTGG - Intergenic
959468054 3:106714438-106714460 GCAAGGTACTTTCTGGATTCAGG + Intergenic
961746392 3:129066097-129066119 GCCAGGGGCTCTCGGGCCTCTGG + Intergenic
962284636 3:134075720-134075742 GGGAAGGGCTGTCTGGACTCTGG - Intronic
963836712 3:150065306-150065328 GGGAGGGGCTCTCTGCATTTGGG - Intergenic
967951858 3:194847504-194847526 GGCAGGGTCTCTCTGGATTAAGG + Intergenic
968137547 3:196229758-196229780 GCGAGGGGATCACTGGAGCCAGG + Intronic
969148578 4:5146328-5146350 GCCAGGGGCTCTCAGGCTTTCGG - Intronic
972116820 4:35646496-35646518 GCCAGGGGCTCTCAGGCCTCTGG - Intergenic
973305909 4:48649806-48649828 GCTAGAGGCCCTCTGGTTTCAGG - Intronic
973737396 4:53885890-53885912 GAGGAGGGCTCTCTGGAGTCTGG + Intronic
980251737 4:130324507-130324529 GTGGGGGGATCTCTGGAGTCTGG + Intergenic
981220359 4:142225280-142225302 GCCAGGGGCTCTCTGGCCTTTGG + Intronic
984845385 4:184103856-184103878 GCCAGGGGCTCGCTGGGGTCAGG - Intronic
985552459 5:540574-540596 GGGATGGCCTCTCTGGATTTTGG + Intergenic
985848473 5:2371463-2371485 GAGAGGGTCTCACTGGACTCTGG + Intergenic
986271713 5:6236946-6236968 GAGTGTGGCTCTCTGGATTATGG - Intergenic
990542968 5:56793001-56793023 GCAAGGTGCTCTCTGCATTTTGG - Intergenic
992966471 5:82006751-82006773 GCCAGGGGCTGTGGGGATTCTGG - Intronic
998148137 5:139742022-139742044 GCCAGGTGCTTCCTGGATTCAGG + Intergenic
1005265674 6:24109778-24109800 GCCAGGGGCTCTCTGGCCTTTGG - Intergenic
1006628091 6:35411879-35411901 GCCAGGGGCTGCATGGATTCTGG - Intronic
1006844979 6:37055893-37055915 GCAAGGGGCTATTTGGGTTCTGG + Intergenic
1007634844 6:43293150-43293172 GCGAGGGCCTCTCTGGTCCCTGG + Intergenic
1008845958 6:55964389-55964411 ACAAGGGCCTCTCTGGATTTGGG - Intergenic
1010395147 6:75383152-75383174 TGGAGGGGCTCTGTGGAATCAGG + Intronic
1012736890 6:102959209-102959231 GCCAGGGGCTCTCTGGCCTTAGG + Intergenic
1013604936 6:111738892-111738914 GGGAGGGGCTTTCTGCCTTCTGG + Intronic
1014113961 6:117651952-117651974 GCCAGGGGCTCTCAGGACTTTGG - Intergenic
1017182385 6:151565368-151565390 GTGAGGGGCTCTCTGGTGGCTGG + Intronic
1017566293 6:155691098-155691120 GTGATGTGATCTCTGGATTCAGG + Intergenic
1019017143 6:168888160-168888182 GCGAGAGGCTCTCTGCATCCTGG - Intergenic
1020447179 7:8281260-8281282 GCGAGGCTCTCTGTGGTTTCTGG + Intergenic
1020976979 7:15018547-15018569 GCCAGGGGCTCTCGGGCTTTAGG + Intergenic
1021845133 7:24756855-24756877 GCTAGGAGCTCTCTAGATACCGG + Intronic
1022111613 7:27235738-27235760 GCCAGCGGCTCCCTGGCTTCTGG + Intergenic
1022631400 7:32088693-32088715 GCGAGTGGCTCACTGGAGTGAGG - Intronic
1023554328 7:41404929-41404951 GGGAGGGCCTGGCTGGATTCTGG + Intergenic
1025201746 7:56966528-56966550 GCGGAGGGCGCTTTGGATTCTGG + Intergenic
1025670200 7:63610400-63610422 GCGGAGGGCGCTTTGGATTCTGG - Intergenic
1030196727 7:106859964-106859986 GGGAGGGGCTGTCTGGGTTTTGG + Intergenic
1031643417 7:124193468-124193490 GCCAGGGGCTCTCAGGCTTTTGG - Intergenic
1033483265 7:141762470-141762492 GGGAGGGGCAGTGTGGATTCAGG + Intronic
1034123216 7:148645930-148645952 GCCAGGGGCTCTCAGGCTTTTGG + Intergenic
1034900630 7:154906032-154906054 GCGGGGGGCTCCCTGGATTGTGG + Intergenic
1035356694 7:158280010-158280032 CCGCGGGGCTCTGTGGGTTCGGG - Intronic
1038055473 8:23853776-23853798 TCTAGGGGCTCTCTGGCTACGGG + Intronic
1045740421 8:105352003-105352025 GAGAGGGGCACCCAGGATTCAGG + Intronic
1050436032 9:5611835-5611857 GCGTGGGGCTCTATGGAACCCGG - Intergenic
1056334598 9:85554580-85554602 CTCAGGGGCTCTCTGGACTCAGG + Intronic
1056447053 9:86676277-86676299 GCGAGGGGGTCTCGGGCTTCAGG + Intergenic
1058543798 9:106039745-106039767 GCTACGGGCTCTCTGGCTTTCGG + Intergenic
1058816233 9:108684999-108685021 GGGAGGAGCTCTCTGGGGTCAGG - Intergenic
1060031433 9:120218076-120218098 GCTAGTGGCTCTGTGGATTTGGG - Intergenic
1062290866 9:135793787-135793809 GGGAGAGGCTGTGTGGATTCAGG + Intergenic
1062371455 9:136241267-136241289 GCCAGGTGCTCACTGGACTCGGG - Intronic
1186267797 X:7850649-7850671 GCCAGGGGCTCTCTGGCCTTTGG + Intergenic
1187362913 X:18644710-18644732 GCAGGGGGCTCTTTGGATGCTGG - Intronic
1190679038 X:52808725-52808747 GCCAGGGGCTCTCGGGACTTTGG + Intergenic
1193852268 X:86553186-86553208 GCCAGGGGCTCTAGGGATTTTGG - Intronic
1198615327 X:138452300-138452322 GCCAGGGGCTCTCGGGCTTATGG + Intergenic
1198683615 X:139205508-139205530 GAGAAGGGCTCTCTGGGATCTGG + Intronic
1199736930 X:150693712-150693734 GCGCGGGGCCCTCGGGAGTCGGG - Intronic
1200954644 Y:8931072-8931094 GCCAGGGCATCTCTGGCTTCTGG - Intergenic
1202601809 Y:26601251-26601273 GCGAGGGGCCCTCTGGATACAGG - Intergenic