ID: 1167694097

View in Genome Browser
Species Human (GRCh38)
Location 19:51003776-51003798
Sequence TGGAGAACAAACTCTGTCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167694097_1167694102 27 Left 1167694097 19:51003776-51003798 CCAGTGACAGAGTTTGTTCTCCA 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1167694102 19:51003826-51003848 TGACTGGAAACAGCGCTGTCAGG 0: 1
1: 0
2: 1
3: 10
4: 98
1167694097_1167694101 11 Left 1167694097 19:51003776-51003798 CCAGTGACAGAGTTTGTTCTCCA 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1167694101 19:51003810-51003832 TTGGCACACTGCAGTGTGACTGG 0: 1
1: 0
2: 0
3: 11
4: 143
1167694097_1167694103 28 Left 1167694097 19:51003776-51003798 CCAGTGACAGAGTTTGTTCTCCA 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1167694103 19:51003827-51003849 GACTGGAAACAGCGCTGTCAGGG 0: 1
1: 0
2: 2
3: 6
4: 97
1167694097_1167694099 -8 Left 1167694097 19:51003776-51003798 CCAGTGACAGAGTTTGTTCTCCA 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1167694099 19:51003791-51003813 GTTCTCCAGGATGCTGATGTTGG 0: 1
1: 0
2: 1
3: 39
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167694097 Original CRISPR TGGAGAACAAACTCTGTCAC TGG (reversed) Exonic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
901329663 1:8396031-8396053 TGGGGAACAAAGTCTTTCTCTGG - Intronic
905901835 1:41586434-41586456 TGGGGAACAAACTCTGGCCATGG - Intronic
908426553 1:64013510-64013532 TGAAGAACAAACCCAGTCAGAGG - Intronic
910000893 1:82340916-82340938 TGCAGCACACACTCTGTCACTGG - Intergenic
910109976 1:83672664-83672686 TGAAGAAAAAAGTCTGTCCCTGG - Intergenic
910347639 1:86258733-86258755 TGGAAAACACACTCTTTCATTGG + Intergenic
910356171 1:86358645-86358667 TGGAAAACAAACTCTTACAGAGG + Intronic
910508887 1:87981484-87981506 TGTAGTACTAACTCTGACACTGG - Intergenic
910755790 1:90689092-90689114 TGGAAAACAAATTCTGTTATGGG + Intergenic
912951213 1:114121919-114121941 TGGACAACAATCTCTACCACAGG - Intronic
914219172 1:145662699-145662721 AGGTGAGCAAACTCTGCCACTGG - Intronic
914471755 1:147985570-147985592 AGGTGAGCAAACTCTGCCACTGG - Intronic
918695181 1:187536948-187536970 AGCAGGACAAACTCTGTTACTGG + Intergenic
924530991 1:244893785-244893807 TGGAAAATACAATCTGTCACAGG - Intergenic
1063190066 10:3685238-3685260 TGGATGAAAAACTCTGTCCCCGG + Intergenic
1063712192 10:8490419-8490441 TGGAGAACAATGCATGTCACTGG - Intergenic
1065374091 10:25019106-25019128 TGGAGAACTAACTGTGTATCAGG - Intronic
1065981079 10:30897860-30897882 AGGTGAACAATCTCTGTCAGCGG - Intronic
1067980733 10:51081687-51081709 TGGAGCACTAACTCTGTGCCAGG + Intronic
1067986517 10:51153003-51153025 TGGAGAACAAAGTATGTCCATGG - Intronic
1068552711 10:58424625-58424647 TTGAGAATAAACTCTGTTAGTGG - Intergenic
1069218015 10:65846366-65846388 TTGAGAAATTACTCTGTCACTGG - Intergenic
1071674896 10:87646410-87646432 CAGAGAACAACCTGTGTCACAGG - Intergenic
1073331569 10:102673379-102673401 TGGAGAACAAAAACAGTCAATGG - Intergenic
1074860943 10:117510061-117510083 TTGAGCACCCACTCTGTCACAGG + Intergenic
1078611517 11:12823732-12823754 TGGACAAAAAAATCTGACACTGG - Intronic
1079753922 11:24232085-24232107 TGAAGAACAAAGTCTTTCATTGG + Intergenic
1081392424 11:42544650-42544672 TGCAGAATAAAATCTGTCTCAGG + Intergenic
1081501932 11:43675639-43675661 TGGACAACAAACTCCAACACAGG + Intronic
1083029139 11:59575980-59576002 TATAGAACAATCTCTCTCACAGG + Exonic
1085159421 11:74327078-74327100 TGGAGAATAAACACTGGCAAAGG - Intergenic
1086004363 11:82019730-82019752 TAGAATACATACTCTGTCACTGG - Intergenic
1086022691 11:82250933-82250955 AGGAGAACATACTGTGTCAGCGG - Intergenic
1086248392 11:84783765-84783787 TGGAGGAAAAACTCTGAAACAGG - Intronic
1088658715 11:112026009-112026031 TGGAGGAGAAAGCCTGTCACTGG + Intronic
1089439155 11:118500470-118500492 TGGAGCACAGACTGTGTCATAGG - Intronic
1091100844 11:132872149-132872171 TTGAGCACAAACTATGTCCCAGG - Intronic
1097640796 12:62178805-62178827 TGGAAAACAATCTCTGTCTCTGG - Intronic
1100832123 12:98526192-98526214 TGGTGACTAAACTGTGTCACAGG + Intronic
1101281718 12:103264271-103264293 TGTAAAACAAATTCTGTCATTGG + Intronic
1103612936 12:122135124-122135146 TTGAGAACAAGCTGTCTCACTGG + Intronic
1104109416 12:125690643-125690665 TGGAGAAAACACTCACTCACAGG - Intergenic
1105766881 13:23568481-23568503 TGGTGAATAAACTCTTCCACTGG + Intergenic
1108778668 13:53799584-53799606 TGGAAAATATAATCTGTCACAGG + Intergenic
1108955847 13:56156081-56156103 TGCAGGACATATTCTGTCACTGG - Intergenic
1111174834 13:84580633-84580655 TTGAGAACAAGCTCAGTAACAGG + Intergenic
1111880527 13:93950743-93950765 TGCACAACCAACTCTGTCAAGGG - Intronic
1112099078 13:96167349-96167371 TGGAGAAATAACTCTGGCAGAGG - Intronic
1118825159 14:69373200-69373222 TGGAGTACCTACTCTGTTACAGG - Intergenic
1119621550 14:76135623-76135645 TTGAGAGCACACTCTTTCACTGG - Intergenic
1120200113 14:81528860-81528882 TTGATAACAAACTCTAACACAGG - Intronic
1120311916 14:82839707-82839729 TGGGTAACAATCTCTATCACAGG - Intergenic
1120823547 14:88934940-88934962 TGGACAAGGACCTCTGTCACTGG + Intergenic
1121417876 14:93791373-93791395 TGAAGACCAGGCTCTGTCACAGG + Intergenic
1122428571 14:101625741-101625763 TTGAGAACCAACTCTGACTCAGG - Intergenic
1128698188 15:69784574-69784596 TGGCCAACAAATTCTTTCACAGG + Intergenic
1130397450 15:83515328-83515350 TGGAGAACAAAATAAGACACAGG - Intronic
1132532135 16:457342-457364 TGGAGAATCCACTCAGTCACTGG - Intronic
1135509462 16:23069560-23069582 TGGATGACAAACTCTGACGCTGG + Exonic
1137737964 16:50739073-50739095 TGGAGAACAACCCCTGTCCTTGG + Intergenic
1142778936 17:2165203-2165225 TGAAGAAGAAATTCTGTCATTGG - Intronic
1148213491 17:45821754-45821776 GGGAGACCAGACTCGGTCACAGG + Intronic
1152915067 17:83030431-83030453 AGGAGAACAGCCTCTGACACGGG + Intronic
1155381598 18:25228210-25228232 TGCAGACCAAAATCTGTTACGGG + Intronic
1155756445 18:29503163-29503185 TGGCGACCACACTTTGTCACAGG + Intergenic
1156335505 18:36167971-36167993 TGGAGAACATACTCTGAGGCTGG - Intronic
1156339368 18:36197356-36197378 TGTAGAACAGACTCTTGCACTGG + Intronic
1158576900 18:58645724-58645746 TGGAGCCAAAACTCTGGCACCGG - Intergenic
1159624194 18:70672723-70672745 TCCAGAACAATCTCTGTCAAGGG + Intergenic
1162163333 19:8735639-8735661 TGGGCAACAGACTCTGTCTCAGG - Intergenic
1162956642 19:14102508-14102530 AGGAGCACAAACTCTGCCCCAGG - Intronic
1167694097 19:51003776-51003798 TGGAGAACAAACTCTGTCACTGG - Exonic
925471753 2:4169871-4169893 TGGAGCACAATTTCTGTCTCTGG + Intergenic
925989847 2:9245860-9245882 TTGAGAACAAGTTCTGTCCCAGG - Intronic
926946411 2:18192251-18192273 TGGAGTACAAATTCTGCCAATGG - Intronic
927045380 2:19272842-19272864 TGGAGAAGAATCATTGTCACTGG + Intergenic
934538516 2:95156634-95156656 TGGAGAACAAAACCTGTATCAGG - Intronic
935101112 2:99997160-99997182 TGGAGAACGAAATCTGTATCTGG - Intronic
935333087 2:101991618-101991640 TGGAAAACCAACTCTTCCACTGG + Intergenic
935816431 2:106850284-106850306 GAGAGAGCAAACTCTGCCACAGG - Intronic
936823454 2:116552588-116552610 TGGAGAACATATTCTGTCTATGG + Intergenic
938926468 2:136047729-136047751 TGCAGAACCAACACTGTAACTGG - Intergenic
941341698 2:164313694-164313716 TTGAGTACAAACTATGTGACTGG - Intergenic
943763758 2:191638040-191638062 TGGAGAACAAACTCACTCCCTGG + Intergenic
943923027 2:193734602-193734624 TGGACTACAAACTCTTTTACGGG + Intergenic
944318986 2:198313634-198313656 TGGAGAACAAAAGCTGAAACAGG - Intronic
948169666 2:235890746-235890768 TGGAGAACGAATTCTTTCACTGG + Intronic
948495858 2:238349434-238349456 TGGAGAACACACTGTGTGGCTGG - Intronic
1169746493 20:8948276-8948298 TGCAGAACAAGTTCTCTCACTGG + Intronic
1170055399 20:12197285-12197307 TGCAGAACAAATTCTTTCATGGG + Intergenic
1170627128 20:18038556-18038578 TGGAGAATTAACTCAATCACAGG + Intronic
1170789128 20:19493425-19493447 TGGAGTACCAACTCTATAACAGG - Intronic
1176685406 21:9844462-9844484 TGAAGAACATTCTCTGTCAAGGG + Intergenic
1179353169 21:40632530-40632552 TGGAGCACATACTGTGTCCCAGG - Intronic
1179428434 21:41301513-41301535 TGGAGAACAAACTATGAGAAGGG + Intergenic
1179989361 21:44939100-44939122 TCGAGAACAAACTATGGAACAGG - Intronic
1182153696 22:28049306-28049328 AGGAGAACCAAGTCAGTCACTGG + Intronic
949328099 3:2889882-2889904 TGGAAAATCAACTTTGTCACTGG + Intronic
949734938 3:7160931-7160953 TTGAGAACACACTGTGTCCCAGG - Intronic
951036408 3:17937556-17937578 TGGGGAACAAAAGCTTTCACTGG + Intronic
955023545 3:55144877-55144899 TGGAAAAAAAAATCTGTCACAGG - Intergenic
955957889 3:64309224-64309246 AGCAGAACAAACTCAGACACAGG + Intronic
957764393 3:84603190-84603212 TGGAGAAAAAGGTATGTCACTGG - Intergenic
963620923 3:147605330-147605352 TGTAGAACAAAGTGTGTAACAGG - Intergenic
965503108 3:169479828-169479850 TTGAGCACATACTCTGTCCCAGG + Intronic
966063779 3:175791519-175791541 TTGTGGACAAACTCTGTCAGTGG + Intronic
966197628 3:177329135-177329157 TGGAAAACAAACTCTATAAATGG + Intergenic
967953430 3:194858386-194858408 TTGAGAACCAGCTCTGCCACTGG + Intergenic
970550750 4:17178559-17178581 TGGAGAACACACGCTTTCATGGG - Intergenic
971379162 4:26081139-26081161 TGTAGCACAAACGCTGCCACAGG - Intergenic
971878610 4:32338845-32338867 TTGAGAACAAACTTTATCTCAGG - Intergenic
973872861 4:55184156-55184178 TGGAGAACATACTGTGTACCAGG - Intergenic
978500068 4:109399978-109400000 TGGAGACCAAACCCAGTGACAGG - Intergenic
981009157 4:139906833-139906855 AGGTGAAAAAACTCTGTCCCAGG - Intronic
985670226 5:1203104-1203126 TGGAGGAGAAACTGAGTCACAGG + Intronic
987126379 5:14816823-14816845 TGGCAAACAAACTCTCCCACGGG + Intronic
989109296 5:37891397-37891419 TGGAGAAGAAACTGTTTCAATGG - Intergenic
989807080 5:45622492-45622514 TGGAGAAAAAATTCTGCTACAGG - Intronic
990882733 5:60557789-60557811 TGGAAAACAAAAACAGTCACAGG + Intergenic
992585409 5:78233619-78233641 TGAAGAACAAAAGCTGTCGCAGG - Intronic
996335051 5:122374507-122374529 TGGAAAACAGACCCTGTCATTGG + Intronic
997673483 5:135695374-135695396 TTGAGAACAGACTCTGTGCCAGG - Intergenic
1002595016 5:180316482-180316504 TGGAGACTAAAGTCAGTCACAGG + Intronic
1003951762 6:11122801-11122823 TGGAGGACAGCCTCTATCACAGG - Intronic
1007477640 6:42129579-42129601 TGGAGCACAGACTCAGTAACTGG - Intronic
1007803408 6:44417585-44417607 TGGAAAATAAACTTTGCCACAGG + Intronic
1010807204 6:80251416-80251438 TAGTGAACACAGTCTGTCACAGG + Intronic
1013296922 6:108766011-108766033 TCAAGAACAAATGCTGTCACTGG - Intergenic
1018719822 6:166564060-166564082 TGGATAATAAACTATGTCCCAGG + Intronic
1022768532 7:33443356-33443378 TGGAGGACTAATTTTGTCACTGG + Intronic
1024541767 7:50480532-50480554 TGGAGACCCAACACTGTAACTGG + Intronic
1024568178 7:50701630-50701652 TTGAGAAAAAAATGTGTCACTGG - Intronic
1024600497 7:50976242-50976264 AGGAAAACACACACTGTCACTGG + Intergenic
1028236476 7:88368853-88368875 GGGAGAATCACCTCTGTCACTGG + Intergenic
1030434848 7:109503631-109503653 TGGAAAACTAGCTCTTTCACTGG + Intergenic
1030714482 7:112791665-112791687 TGTAGTACAGAGTCTGTCACAGG - Intergenic
1030726204 7:112927642-112927664 TGGAGAACAAAATCTGCAATGGG + Intronic
1035971053 8:4249738-4249760 TGGAGAACAAAGTCTATTAATGG + Intronic
1038151482 8:24944878-24944900 TCGAGAACAAGCTGTGTCCCAGG + Intergenic
1038954938 8:32457449-32457471 TGGAGAAAAAAATCAGTGACAGG - Intronic
1044473094 8:92595163-92595185 TAGAGCAAAAACTCTGTCTCTGG - Intergenic
1046049445 8:109004287-109004309 TGGAGAATTAACTCAGTCAATGG + Intergenic
1052352579 9:27472362-27472384 TGGAAAACAACATCTGCCACAGG + Intronic
1052436363 9:28435063-28435085 TGGGAAACAAACTTTGTCACTGG + Intronic
1053616809 9:39775700-39775722 TGGAGAGCATATTCTGTGACAGG + Intergenic
1053783903 9:41637143-41637165 TGAAGAACATTCTCTGTCAAGGG - Intergenic
1053874988 9:42535036-42535058 TGGAGAGCATATTCTGTGACAGG + Intergenic
1053897642 9:42759573-42759595 TGGAGAGCATATTCTGTGACAGG - Intergenic
1054171858 9:61847284-61847306 TGAAGAACATTCTCTGTCAAGGG - Intergenic
1054236708 9:62566683-62566705 TGGAGAGCATATTCTGTGACAGG - Intergenic
1054267359 9:62931738-62931760 TGGAGAGCATATTCTGTGACAGG - Intergenic
1054446719 9:65376297-65376319 TGAAGAACATTCTCTGTCAAGGG - Intergenic
1054550844 9:66601191-66601213 TGGAGAGCATATTCTGTGACAGG - Intergenic
1054665677 9:67733528-67733550 TGAAGAACATTCTCTGTCAAGGG + Intergenic
1057476916 9:95411069-95411091 TGAAGTGCAAACACTGTCACTGG + Intergenic
1058084009 9:100729883-100729905 GGGACAACAAATTCTGTCAATGG - Intergenic
1062432991 9:136534247-136534269 TGCTGAACAAACTCTTCCACAGG - Intronic
1192134344 X:68582967-68582989 TGCAGAACTAACACTGTCAGTGG - Intergenic
1192746165 X:73941273-73941295 TGGCAACCAAACTCTGTCTCTGG + Intergenic
1194373720 X:93107421-93107443 TGAAGAACTAACACTGTCAGTGG + Intergenic
1194570838 X:95552732-95552754 TGGAGAAGAAATTCTGTCTCAGG - Intergenic
1197845915 X:130802626-130802648 GGGAGACCAAACTCTGCCACTGG - Intronic
1200061708 X:153486698-153486720 TGGAGAACAACCTCATTGACCGG + Exonic
1200681749 Y:6221461-6221483 TGAAGAACTAACACTGTCAGTGG + Intergenic