ID: 1167694115

View in Genome Browser
Species Human (GRCh38)
Location 19:51003919-51003941
Sequence CAGCTTTTCCAAAGGACCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 212}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167694109_1167694115 -7 Left 1167694109 19:51003903-51003925 CCCTGAGTCCTCCCTGCAGCTTT 0: 1
1: 0
2: 1
3: 34
4: 297
Right 1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG 0: 1
1: 0
2: 0
3: 22
4: 212
1167694106_1167694115 1 Left 1167694106 19:51003895-51003917 CCCCACTGCCCTGAGTCCTCCCT 0: 1
1: 3
2: 8
3: 64
4: 603
Right 1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG 0: 1
1: 0
2: 0
3: 22
4: 212
1167694110_1167694115 -8 Left 1167694110 19:51003904-51003926 CCTGAGTCCTCCCTGCAGCTTTT 0: 1
1: 0
2: 1
3: 32
4: 283
Right 1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG 0: 1
1: 0
2: 0
3: 22
4: 212
1167694107_1167694115 0 Left 1167694107 19:51003896-51003918 CCCACTGCCCTGAGTCCTCCCTG 0: 1
1: 0
2: 9
3: 77
4: 509
Right 1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG 0: 1
1: 0
2: 0
3: 22
4: 212
1167694108_1167694115 -1 Left 1167694108 19:51003897-51003919 CCACTGCCCTGAGTCCTCCCTGC 0: 1
1: 0
2: 9
3: 105
4: 711
Right 1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG 0: 1
1: 0
2: 0
3: 22
4: 212
1167694105_1167694115 16 Left 1167694105 19:51003880-51003902 CCAACACACTCAGCACCCCACTG 0: 1
1: 0
2: 2
3: 28
4: 301
Right 1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG 0: 1
1: 0
2: 0
3: 22
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167694115 Original CRISPR CAGCTTTTCCAAAGGACCAA TGG Intronic
901128313 1:6944770-6944792 CAGTTTTTCCACTGTACCAATGG + Intronic
901251039 1:7780462-7780484 CAGCCTTTCAAAAGGAAGAAAGG - Exonic
902630318 1:17700950-17700972 CAGCTTTTCCACAGGAAGAGCGG + Intergenic
902708179 1:18220937-18220959 CAACTTTTCCTATGGAGCAATGG + Intronic
903313807 1:22484027-22484049 CATCTTTGACAAAGGAGCAAAGG - Intronic
906993430 1:50763771-50763793 AATATTTTCCAAATGACCAATGG + Intronic
908708136 1:66983152-66983174 CAGCTTTTTCAAAGGAAGGAAGG + Intronic
910681975 1:89876026-89876048 GAGCTTTTCAAAAGGACCTCAGG - Intronic
913099193 1:115547372-115547394 CAGATTTCCCAAAGGAACATTGG + Intergenic
913664307 1:121033390-121033412 CACCTATTCCAAGGGGCCAATGG - Intergenic
914015697 1:143816669-143816691 CACCTATTCCAAGGGGCCAATGG - Intergenic
914162086 1:145144339-145144361 CACCTATTCCAAGGGGCCAATGG + Intergenic
914654317 1:149725210-149725232 CACCTATTCCAAGGGGCCAATGG - Intergenic
916029342 1:160862672-160862694 CAGCATTTCCACAGGACAGAGGG + Exonic
916558367 1:165911867-165911889 CAGGTTGTCCTAAGAACCAAAGG - Intergenic
917675613 1:177316372-177316394 CTGCTTTCCCAAAGGATAAAAGG + Intergenic
921329928 1:214025344-214025366 CAGCTTTTCTAGAGGCCTAATGG - Intronic
922854321 1:228761107-228761129 CAGCTTATCCAAAGAACGTAGGG + Intergenic
924181975 1:241447876-241447898 CAGCCTTTCCCAAGCACCCAAGG + Intergenic
924451288 1:244181396-244181418 CAGCTTTTCTAAACTACCTAAGG - Intergenic
1064031474 10:11885812-11885834 CAGCTTCTCCAGAGGAACAAGGG + Intergenic
1066081899 10:31938974-31938996 GAGGTTTTCCAGAGGCCCAAAGG - Intergenic
1068704774 10:60062523-60062545 CAGTTTTTCCAAAGAATAAATGG + Intronic
1074905598 10:117860617-117860639 CAGCATTTGCAAAGGTCCCAAGG - Intergenic
1075186423 10:120263209-120263231 CACCTTTTCCAAATGATCTAGGG - Intergenic
1075371601 10:121940756-121940778 GATCTTTTGCAAAGGAGCAAAGG + Intergenic
1076356983 10:129860398-129860420 CATCTTCCCCAAAGGACAAAAGG - Intronic
1077395787 11:2320528-2320550 TAGCTTTTCCCAGGGACGAAGGG - Intergenic
1077859915 11:6168880-6168902 AAGTTTTTCCAGATGACCAAAGG + Intergenic
1078307162 11:10201259-10201281 CAGATTTTCCAAATCACAAATGG - Intronic
1080243234 11:30151331-30151353 CAGCTTTTCCATAAGACATAGGG + Intergenic
1080469207 11:32528685-32528707 CAGCATGTGCAAAGGCCCAATGG - Intergenic
1081166785 11:39817486-39817508 CAGCTTATACAAAGAACAAAGGG + Intergenic
1085080447 11:73629502-73629524 CAGCTGTTCCAAAGGCCCTGGGG - Intergenic
1086975009 11:93121267-93121289 CAGGTTTCCCAAAGGAGAAATGG + Intergenic
1088442220 11:109883667-109883689 CAGCTTTTCTAAAGCAGCACAGG + Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1091027097 11:132151200-132151222 AACCTTGTCCAAAGGAACAATGG - Intronic
1091830736 12:3549651-3549673 CTGATTTACTAAAGGACCAAAGG - Intronic
1092530272 12:9338398-9338420 CAACTTGTCCACAGGACAAAAGG + Intergenic
1097278852 12:57831967-57831989 AAACTATTCCACAGGACCAAGGG + Intronic
1100059396 12:90554739-90554761 CATCTTTGACAAAGGAGCAAAGG - Intergenic
1100142811 12:91639447-91639469 CAGTTTTACCAAAGCAGCAAGGG - Intergenic
1100789561 12:98115561-98115583 CAGTTTATCCAAAGGAGAAATGG - Intergenic
1101195303 12:102376061-102376083 CAGCTGTGGCAAAGGAACAAAGG - Intergenic
1102820778 12:115907576-115907598 CCGCTTGTCCATAGGAACAATGG + Intergenic
1104209658 12:126676613-126676635 GAGGTTTTCCAAAGGACAAAGGG - Intergenic
1105486872 13:20842112-20842134 CAGCTTTTCCAAATGTAAAATGG - Intronic
1105622502 13:22082363-22082385 CACCTTCTTCAAAGGACCAGAGG + Intergenic
1105844993 13:24286412-24286434 CAGCTTTTCCAAAGTACCTGGGG + Intronic
1106150166 13:27092580-27092602 CATCTTTGACAAAGGAGCAAAGG + Intronic
1106567576 13:30899690-30899712 CAGCTTGTCCACAGCATCAAGGG + Intergenic
1106888093 13:34212131-34212153 CAGGTTTTCCACAGAACCATGGG + Intergenic
1109085435 13:57965704-57965726 CAGATTTTCCAAAAGCCCTAGGG + Intergenic
1110540094 13:76698432-76698454 CAGCTTGTGCAGAGGAGCAATGG - Intergenic
1112391320 13:98987017-98987039 CAGCTTTATTAAAAGACCAAAGG + Intronic
1113754625 13:112802464-112802486 CATCTTTGACAAAGGAGCAAAGG + Intronic
1116310005 14:43312823-43312845 CAGCTGCTCCAAGAGACCAAAGG - Intergenic
1116477292 14:45355697-45355719 CATCATATGCAAAGGACCAATGG + Intergenic
1116824375 14:49657811-49657833 CAAATTTTCCCAAGGAGCAATGG - Intronic
1118167636 14:63353518-63353540 CAGCTTTTCCTAAAAACCATAGG - Intergenic
1118695428 14:68380260-68380282 TAGCTTTTCAAGATGACCAACGG - Intronic
1120737804 14:88074596-88074618 TAGCTTTAACAAAGGAGCAATGG + Intergenic
1124071093 15:26393739-26393761 CAGCTTTTCCAATGAACAATGGG - Intergenic
1125013617 15:34908088-34908110 CACCTTTTCAAAGGGACAAAAGG + Intronic
1127918994 15:63478417-63478439 AAGCATTTCCCAAGGACCACAGG - Intergenic
1131939916 15:97550744-97550766 CTGCTTTTCAAAAATACCAAAGG - Intergenic
1131971339 15:97896548-97896570 CAGCATTTCCAAAGGAAAATTGG - Intergenic
1134234763 16:12456792-12456814 GAGCTTTTCCAAAGGTGGAAAGG + Intronic
1134739212 16:16527650-16527672 CAGCATGTGCAAAGGACCAGAGG - Intergenic
1134928288 16:18184501-18184523 CAGCATGTGCAAAGGACCAGAGG + Intergenic
1135219924 16:20605150-20605172 AGGGTCTTCCAAAGGACCAATGG + Intergenic
1136270153 16:29143775-29143797 CAGCATTTTCAAAGGGCCCAGGG + Intergenic
1136625768 16:31461388-31461410 CAGCCTTTCCAAAGGCCCAGAGG - Intronic
1137609485 16:49809318-49809340 CAGCTTTTCCAAGGGCCCCCAGG - Intronic
1139526132 16:67518054-67518076 CAGCATTAGCAAAGGCCCAAGGG + Intergenic
1141215847 16:82023274-82023296 CTGCTATTCCAAAGTACCAGAGG + Intergenic
1142073746 16:88105609-88105631 CAGCATTTTCAAAGGGCCCAGGG + Intronic
1143656946 17:8300463-8300485 GATTTTTTACAAAGGACCAAAGG - Intergenic
1146938682 17:36828472-36828494 CAGTTTTCCCAGAGGACCAATGG + Intergenic
1147033327 17:37659906-37659928 CTGCTTTTCCCAAGGACCCAGGG - Intergenic
1148251818 17:46088135-46088157 CTGCTTTACACAAGGACCAAAGG + Intronic
1148368405 17:47073859-47073881 CTGCTTTACACAAGGACCAAAGG + Intergenic
1151093567 17:71470440-71470462 CAACTTATCCAAAGGACTCAAGG + Intergenic
1155917842 18:31573458-31573480 GAGCTTTTCTTCAGGACCAAGGG + Intergenic
1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG + Intronic
1157681761 18:49613057-49613079 CAGCTTTTCCAAGGGACCTGAGG - Intergenic
1159874360 18:73793724-73793746 CAGCTTTTCCCAGGGTCCAGGGG + Intergenic
1160523791 18:79523978-79524000 CAGCTTTTCCACAGACACAAAGG - Intronic
1164269583 19:23659784-23659806 CTGCTTTTCCAGAGGCCCAGAGG + Intronic
1165294554 19:34916227-34916249 CAGCTCTTCCAAAGTCCCCAGGG - Intergenic
1167694115 19:51003919-51003941 CAGCTTTTCCAAAGGACCAATGG + Intronic
925392560 2:3506856-3506878 GATCTTTGACAAAGGACCAAAGG + Intronic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
928647089 2:33366048-33366070 CATCTTTTCCATTTGACCAAAGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931548342 2:63413850-63413872 GAGCTTTTGCAAAGAACAAAAGG + Intronic
934732131 2:96666053-96666075 CTGCATTTCCAAAGGGCTAAAGG - Intergenic
936479957 2:112877044-112877066 CAACTTTTCCAAATGACAATGGG + Intergenic
939009081 2:136824108-136824130 AAACTTTTCCAAAGGTACAAAGG + Intronic
939395886 2:141629138-141629160 TTGCTTTTCCAAAGACCCAAAGG - Intronic
940292819 2:152094297-152094319 CAGCATATGCAAAGGACCAGTGG + Intronic
940682520 2:156804421-156804443 CACCTTTTCTCAAGGACCTATGG - Intergenic
941011706 2:160307613-160307635 CAGGTTTTCCAAAAGGCCCAAGG + Intronic
941275318 2:163483760-163483782 CAGCTAAACCAAAGGTCCAAAGG - Intergenic
942298536 2:174540046-174540068 CACCTTTTCAAAAGGAACAAAGG + Intergenic
942478760 2:176358934-176358956 CAGCTTTTGCTTAGGAGCAAGGG - Intergenic
942625168 2:177892910-177892932 CAGCTTTTCTAGAGTCCCAAAGG - Intronic
943267729 2:185757066-185757088 CAGCTTTTACAACATACCAAAGG + Intronic
943466270 2:188233079-188233101 CAGCTTTTAAAAAGGAAGAATGG + Intergenic
945391708 2:209273149-209273171 TATCTTTTCCAAAGCCCCAAGGG + Intergenic
947410155 2:229829204-229829226 CAGCTTTTCCATAGAACAATTGG - Exonic
948102444 2:235385491-235385513 CAGCTTCTCAAATGGACTAAGGG + Intergenic
948850970 2:240705437-240705459 CAACTGGTCCAAAGGAGCAAAGG - Intergenic
1169125355 20:3123654-3123676 CAGCTGTTCCAAAGACCCAATGG + Intronic
1170036573 20:11996070-11996092 CAGCTTTTCCAACAGTCCCAGGG + Intergenic
1170412515 20:16106698-16106720 CAGCTATTCCCTATGACCAAGGG - Intergenic
1170433788 20:16302404-16302426 TATCTTTTGCAAAGGAGCAAAGG - Intronic
1171353046 20:24519694-24519716 CAACTTTACCAAAAGATCAAAGG - Intronic
1171428645 20:25064662-25064684 CAGATTTCCCTAAGGACCACCGG + Intergenic
1171749415 20:29033853-29033875 CAGCATTTCCAAGGTACCAAGGG - Intergenic
1173789982 20:45822308-45822330 CAGCATGTGCAAAGTACCAAGGG + Intergenic
1175019415 20:55828531-55828553 CAGATTTTTCAAAGCACCCAAGG + Intergenic
1175156891 20:56977256-56977278 CAGCTTGTACAAAGGCCCCAAGG + Intergenic
1176679140 21:9809798-9809820 CAGCTCTTCCAGAAGATCAAGGG + Intergenic
1177522745 21:22250539-22250561 CATCTTTTGCAAAGGAGGAAAGG + Intergenic
1178297376 21:31421612-31421634 CAGTTTTTCCCACGGACCCAAGG - Intronic
1178425310 21:32474368-32474390 CAGCTTGTGCAAAGGCCCAGGGG - Intronic
1178917725 21:36718261-36718283 CAGCTTTTACTTGGGACCAAGGG - Intronic
1180644179 22:17324667-17324689 GATCTTTTTCAAAGGAGCAAAGG + Intergenic
1183550328 22:38479052-38479074 GAGCTTTTCTGAAGGAGCAATGG + Intronic
1184094958 22:42311458-42311480 CACCTTTCCTAAAGGACAAAAGG + Intronic
1185055763 22:48577513-48577535 CAGCCTTCCCAGCGGACCAAGGG - Intronic
1185251369 22:49803409-49803431 CAGCTCTTCCAAAAGACCAGCGG + Intronic
949361782 3:3240252-3240274 GAGCTATTCTAAAGGACCACAGG + Intergenic
949405230 3:3706993-3707015 CAGTTTTTCCAATGGAACATAGG + Intronic
949940687 3:9151980-9152002 CAGCATTTCCATAGGACACATGG - Intronic
950199979 3:11035901-11035923 CAGCTTGTGCAAAGGCCCAGCGG + Intronic
950807336 3:15617549-15617571 CATCTTTGACAAAGGAGCAAAGG - Intronic
950941590 3:16898458-16898480 CAGCTATTCCTTAGGACAAAAGG - Intronic
952347368 3:32501360-32501382 CAGCTTATGCAAAGGAACAGTGG + Intronic
953562555 3:44003961-44003983 CAGCATTACCCAAGCACCAAAGG - Intergenic
955410304 3:58651094-58651116 GGGCTTTTCCAAACCACCAAAGG - Intronic
956537449 3:70292974-70292996 CATCTTTTCCAAAGAAATAAAGG + Intergenic
959017609 3:101153417-101153439 CAACATTTCCAAATGACCAAAGG + Intergenic
960801016 3:121540587-121540609 GAGCTTTACCTAAGCACCAATGG + Intronic
960842189 3:121971100-121971122 CATCTTTGACAAAGGAGCAAAGG - Intergenic
961503447 3:127354428-127354450 CAGCTTTTCCAGAGGACCGTTGG + Intergenic
961701031 3:128744714-128744736 TAGCTTTTCACAAGGACCAATGG - Intronic
963714583 3:148788368-148788390 CAGCATTTACAAAGGCCCTAGGG - Intergenic
966501434 3:180645727-180645749 CAGCTCTTCATAATGACCAAAGG + Intronic
966578801 3:181535946-181535968 CAACATTTTCAAAGGATCAAAGG - Intergenic
970191826 4:13524894-13524916 CAACCTTTCCTTAGGACCAAAGG + Intergenic
970993448 4:22238634-22238656 CAACTTTTCCAGAGCACCCAAGG + Intergenic
974453328 4:62094334-62094356 CACCCTTTCCAAAGGAATAAAGG + Intergenic
974926170 4:68300786-68300808 CAGCTCTCCAAAGGGACCAATGG - Intergenic
975186675 4:71411241-71411263 CAGCATGTCCAAAGACCCAAAGG - Intronic
975285703 4:72616893-72616915 CACCTTTGCCAAAGGAACACAGG + Intergenic
977374853 4:96189131-96189153 GATCTTTTACAAAGGAGCAAAGG - Intergenic
978164974 4:105596297-105596319 CCGCTTTTTCAAAGGAGCAAGGG + Intronic
979514817 4:121595515-121595537 CACCTTTTACAAAGTCCCAAAGG - Intergenic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
983379929 4:166979976-166979998 CAGCTTGTGCAAAGGACCTAAGG - Intronic
984593907 4:181645776-181645798 CATCTTTTTAATAGGACCAAAGG + Intergenic
985543766 5:499146-499168 CGGCTTTTCCCAAGGACCCATGG + Intronic
986212247 5:5685036-5685058 CAGTATTTCCAAGGGACAAAAGG + Intergenic
990877234 5:60499410-60499432 CAGTTCTTCCAAAAGACCAAGGG + Intronic
992985462 5:82224447-82224469 CAGCTTTACCTAAGAAGCAAGGG + Intronic
993731639 5:91429698-91429720 CAGCCTCTCCAGAGGACAAAAGG - Intergenic
994368632 5:98945050-98945072 CAGCTGTTCCCATGGACCCAGGG + Intergenic
996172122 5:120306768-120306790 TAGCTTTTCGAAGGGACAAATGG - Intergenic
1002884298 6:1280394-1280416 CTGCTTTAGCAAAGTACCAAAGG - Intergenic
1003881568 6:10483858-10483880 CAGGTTTTCCAAAGTGCCCACGG + Intergenic
1004100810 6:12609096-12609118 CAGCTTGTCAAGATGACCAATGG + Intergenic
1004596297 6:17102773-17102795 CAGCTTTAAGAAACGACCAAAGG - Intronic
1005767511 6:29027604-29027626 TAGCTTTTCTTAAGGAACAATGG - Intergenic
1006203054 6:32314016-32314038 CAGCTTTGCCTCAGGAACAAAGG - Intronic
1006203710 6:32320503-32320525 CAGCTTTGCCTCAGGAACAAAGG - Intronic
1009269233 6:61597696-61597718 AAGCTTTCCAAAAGGACTAATGG + Intergenic
1010175552 6:73023926-73023948 CAATTTTTTCAAAGGACAAAGGG + Intronic
1011011855 6:82711986-82712008 CAGCTTTTCCTGAGGCCCATAGG - Intergenic
1011988070 6:93475216-93475238 CAGCTTTGACAAAGGGCCAGAGG + Intergenic
1012360882 6:98378102-98378124 CAGCTTTGCCAAAGGTCAGATGG + Intergenic
1012864264 6:104598621-104598643 AAGCTTTTCTATAGGACCAATGG - Intergenic
1013007524 6:106087814-106087836 CAGCTTTTCCACAGTGCCGAGGG + Intronic
1014213198 6:118728288-118728310 CATCTCTTCAAAAGGATCAATGG + Intergenic
1014758368 6:125327060-125327082 CAGCTATTCAGAAGGACCAGAGG - Intergenic
1015121547 6:129706564-129706586 CAGCTTTTCAAAAGACCAAATGG + Intronic
1015807461 6:137125644-137125666 AAGCTTGTTCAAAGGACTAAAGG - Intergenic
1015825064 6:137302532-137302554 CAGCTTCACCAAAGGAGCATGGG - Intergenic
1016845362 6:148563529-148563551 GAGCTATTCCAGAGGACAAAGGG - Intergenic
1017314036 6:153008170-153008192 CAGTTTTGCCAAAGGACTATAGG - Exonic
1022702577 7:32775615-32775637 AAGCTTGCCCAAAGGCCCAAAGG - Intergenic
1023090643 7:36614673-36614695 CAGATTCCCAAAAGGACCAAAGG - Intronic
1023687593 7:42752430-42752452 CAGCTGGTGCAAAGGACCTAAGG - Intergenic
1025599232 7:62974246-62974268 CAGCGTTTCCAAACTGCCAAAGG - Intergenic
1025863002 7:65350547-65350569 CAGCTTTTCAAAAGCAGAAAAGG - Intergenic
1026080433 7:67213792-67213814 CATCTTTGACAAAGGAGCAAAGG - Intronic
1026696656 7:72600233-72600255 CATCTTTGACAAAGGAGCAAAGG + Intronic
1027685345 7:81273703-81273725 CAGCTTTTCCAAAGCAGAAGTGG + Intergenic
1029855063 7:103506624-103506646 CAGTTTATCCAAAGCATCAATGG - Intronic
1031916340 7:127566319-127566341 TTGCTTTTCCACAGCACCAATGG - Intergenic
1032778615 7:135143327-135143349 CATCTTTAACAAAGGAGCAAAGG + Intronic
1033475922 7:141692490-141692512 AATCTTTGCCAAAGGAACAAAGG + Intronic
1036933969 8:12982864-12982886 CAGCTTCTCCAAGGGACAAAAGG + Intronic
1039574397 8:38611762-38611784 AAGCTTCGCCAAGGGACCAACGG + Intergenic
1039789440 8:40863001-40863023 CAGCCTGTGCAAAGGACTAATGG + Intronic
1044922849 8:97184365-97184387 CTGATTTTCCAAAGGGCAAATGG - Intergenic
1044957613 8:97497990-97498012 CAGCCTTTCCCAAGAATCAAAGG - Intergenic
1045112164 8:98946473-98946495 AAGGGTTTCAAAAGGACCAATGG + Intronic
1045317571 8:101056585-101056607 CATATTTTCCAAAGGAAAAATGG + Intergenic
1045781024 8:105863941-105863963 AATCTTTTCCAAAGGAACGACGG + Intergenic
1045865593 8:106862023-106862045 CAACTTTTCCAAAGCAAAAATGG + Intergenic
1051601896 9:18883081-18883103 CAGCTTTTCCACTTGGCCAATGG - Intronic
1052578828 9:30327141-30327163 AGGCTTTTCCAAATGACTAAGGG + Intergenic
1053282720 9:36831420-36831442 AAGTTTTTCCAAATGACAAATGG - Intergenic
1053562878 9:39214306-39214328 AATCTTTTCCACAGCACCAAAGG + Intronic
1053828675 9:42052250-42052272 AATCTTTTCCACAGCACCAAAGG + Intronic
1054134269 9:61404749-61404771 AATCTTTTCCACAGCACCAAAGG - Intergenic
1054601884 9:67135204-67135226 AATCTTTTCCACAGCACCAAAGG - Intergenic
1057412682 9:94831337-94831359 CAGGTTTGCCAAAGGTCAAATGG + Intronic
1059944092 9:119389041-119389063 CATTTCTTCCAAAGGAACAAAGG + Intergenic
1203664310 Un_KI270754v1:12334-12356 CAGCTCTTCCAGAAGATCAAGGG + Intergenic
1185760206 X:2684713-2684735 CAGTTTTTCCACAGAACCAAGGG + Intergenic
1187775694 X:22754134-22754156 CTTTTTTTACAAAGGACCAATGG + Intergenic
1187791130 X:22951323-22951345 CAGCTTATGCAAAGAAACAAAGG - Intergenic
1190617785 X:52254450-52254472 GAGCTTTGACAAAGGAGCAAAGG - Intergenic
1196012944 X:110907421-110907443 CACATTTTGCAAAGGAGCAATGG - Intergenic
1196404977 X:115351758-115351780 CAGAATATCCAAAGAACCAAAGG + Intergenic
1198305654 X:135380156-135380178 CAGGTTTCCCAAAGGACAAGAGG - Intergenic
1199306626 X:146274658-146274680 CAGCTTTGCCAAAGAACAGATGG + Intergenic
1199317878 X:146401324-146401346 GAGATTTGGCAAAGGACCAAGGG + Intergenic
1202280055 Y:23174460-23174482 CAGCTTTTCCAAAGTACTCTTGG - Intronic
1202280784 Y:23185305-23185327 CAGCTTTTCCAAAGTACTCTTGG - Intronic
1202436780 Y:24847602-24847624 CAGCTTTTCCAAAGTACTCTTGG + Intronic