ID: 1167696638

View in Genome Browser
Species Human (GRCh38)
Location 19:51019125-51019147
Sequence TCTCATGGCCAGGATCTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167696629_1167696638 16 Left 1167696629 19:51019086-51019108 CCGGGCGCCAGAGGCGGCGGAGA 0: 1
1: 0
2: 0
3: 22
4: 413
Right 1167696638 19:51019125-51019147 TCTCATGGCCAGGATCTGCTGGG 0: 1
1: 0
2: 2
3: 22
4: 219
1167696632_1167696638 9 Left 1167696632 19:51019093-51019115 CCAGAGGCGGCGGAGAGGTGGAG 0: 1
1: 3
2: 1
3: 31
4: 271
Right 1167696638 19:51019125-51019147 TCTCATGGCCAGGATCTGCTGGG 0: 1
1: 0
2: 2
3: 22
4: 219
1167696628_1167696638 17 Left 1167696628 19:51019085-51019107 CCCGGGCGCCAGAGGCGGCGGAG 0: 1
1: 0
2: 2
3: 27
4: 566
Right 1167696638 19:51019125-51019147 TCTCATGGCCAGGATCTGCTGGG 0: 1
1: 0
2: 2
3: 22
4: 219
1167696625_1167696638 23 Left 1167696625 19:51019079-51019101 CCAGAGCCCGGGCGCCAGAGGCG 0: 1
1: 0
2: 1
3: 26
4: 353
Right 1167696638 19:51019125-51019147 TCTCATGGCCAGGATCTGCTGGG 0: 1
1: 0
2: 2
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167696638 Original CRISPR TCTCATGGCCAGGATCTGCT GGG Exonic
902254682 1:15180334-15180356 GCACATGGCCAGGATCTGCCTGG - Intronic
903537122 1:24074374-24074396 TGACTTGGCCAGGGTCTGCTTGG - Intronic
903650043 1:24916673-24916695 TCTCAGGGCCAGGATATGCCAGG + Intronic
904662492 1:32095670-32095692 CCTCAAGGCCAGGATCACCTCGG + Intronic
905456942 1:38094845-38094867 TCACATGGCCCGGACCTCCTTGG - Intergenic
905936936 1:41832206-41832228 TCTCATTGCCAGCATTTGCCAGG - Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906114791 1:43349255-43349277 TCTCCTAGCCTGGATCTCCTTGG + Exonic
907722319 1:56983580-56983602 TCTCATGGCCAGGATCCAAAAGG + Intergenic
907722658 1:56986673-56986695 TCTCATGGCCAGGATCCAAAAGG - Intergenic
908919283 1:69170341-69170363 TCTCATGGAGAGACTCTGCTAGG + Intergenic
910623749 1:89284584-89284606 TCTCATGGAGAACATCTGCTAGG + Intergenic
912268626 1:108186756-108186778 TCTCATGGTCATGCTCTTCTGGG + Intronic
917589747 1:176463835-176463857 TCTCATGTTCAGTGTCTGCTTGG + Intronic
918962474 1:191298126-191298148 TATCCTGGCCAGAATCAGCTCGG - Intergenic
920250795 1:204621052-204621074 TCTGCTGCCCAGGATCTTCTGGG + Exonic
920415948 1:205799500-205799522 TCATATTGCCAGGATCTGCTGGG + Intronic
1064549664 10:16486481-16486503 GCTCATGCCCAGGCTCAGCTTGG + Exonic
1065184599 10:23159551-23159573 TCTGAAGGCCAGGATCTGCTGGG + Intergenic
1067734207 10:48836837-48836859 TCTCATGTCCACCATCTGCCTGG + Intronic
1068581845 10:58750097-58750119 TCTCATGGTCTGTTTCTGCTAGG - Intronic
1068948470 10:62753922-62753944 TATCAAGGGCAGGATCTGGTGGG + Intergenic
1069848506 10:71390089-71390111 TCTCACAGCCAGGATGTGCTGGG + Intergenic
1074166525 10:110882246-110882268 TCTGATGGCAAGGATATACTTGG + Intronic
1075814807 10:125256716-125256738 TCCCATGGCCAGGATGTGAGGGG + Intergenic
1079139160 11:17796243-17796265 TCTCATGGCCATTCTCTGCATGG - Intronic
1079400701 11:20104240-20104262 TCTCATGGCCAGGATGTGGGAGG + Intronic
1079754492 11:24239493-24239515 GCTCCTGGCCAGGGTATGCTGGG + Intergenic
1083640954 11:64145023-64145045 TCACCAGGCCAGGCTCTGCTGGG + Intronic
1084641516 11:70429289-70429311 TCTCCTGGCCAGGTTTTCCTTGG + Intronic
1085742957 11:79092474-79092496 ACTGATGGCCAGGATGTGATGGG - Intronic
1086256176 11:84879141-84879163 TGTAATGGCCAGGAGCTTCTCGG + Intronic
1088739250 11:112753353-112753375 ACTGATGGCCAGGTTCAGCTTGG - Intergenic
1089373380 11:117977577-117977599 TTTCATGGCCTGGATGTGTTTGG - Intergenic
1089422046 11:118339287-118339309 TCTCATCGTCAGGGCCTGCTGGG - Intronic
1092162217 12:6321928-6321950 TCACATGGCTAGGACCTGGTAGG - Intronic
1095689267 12:45069034-45069056 CCTCATGGACAGCCTCTGCTAGG - Intergenic
1100870805 12:98908104-98908126 TCCCTAGGCCAGGATGTGCTTGG - Intronic
1103179202 12:118893783-118893805 TCTAATATCCAGAATCTGCTGGG - Intergenic
1103284210 12:119786711-119786733 TGTCATTGCCAGGAGCTGCGGGG - Intronic
1103878452 12:124147575-124147597 TCTAACAGTCAGGATCTGCTTGG - Intronic
1104570279 12:129918773-129918795 TCTCAGGGAAAGGCTCTGCTTGG - Intergenic
1104937349 12:132373428-132373450 ACTCATGCCCAGTATGTGCTCGG + Intergenic
1105807193 13:23960533-23960555 TCTCATGGCCTGGGACTCCTTGG + Intergenic
1106814692 13:33394512-33394534 TCTCTCTGCCTGGATCTGCTAGG + Intergenic
1109659047 13:65435155-65435177 TCTCTTGGCTAGTTTCTGCTGGG - Intergenic
1113093505 13:106639070-106639092 TCTCACGGGAAGGAACTGCTTGG - Intergenic
1113460323 13:110478106-110478128 CCTCTTGGCCAGGAGCTCCTGGG - Exonic
1115051847 14:29072524-29072546 TCTCATGGAGAGCCTCTGCTAGG - Intergenic
1118952157 14:70444851-70444873 TCTGATGGCCTGGGGCTGCTTGG - Intergenic
1119383846 14:74245239-74245261 TTTCATGGCCAGCATCTCCCGGG - Exonic
1119779375 14:77268132-77268154 TCTCATGGCTGGGCTCAGCTGGG - Intronic
1120559983 14:85979487-85979509 TGTCATGGGCGGGATCTGGTGGG - Intergenic
1122768675 14:104087383-104087405 TCCCAGGGGCAGGATCTGCCAGG + Intronic
1124698980 15:31894608-31894630 TCTCATGTTCTGGGTCTGCTTGG + Intergenic
1125518346 15:40335251-40335273 TCTCGGGGCCAGGCCCTGCTGGG + Exonic
1126856578 15:52845213-52845235 CCTCCTTGCTAGGATCTGCTGGG - Intergenic
1128660935 15:69500539-69500561 TCACATGGCCATCTTCTGCTAGG + Intergenic
1129376680 15:75138147-75138169 TCTCACAGCCAGGACCTTCTGGG + Intergenic
1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG + Intergenic
1130105917 15:80928385-80928407 TCTCAGGGTCAGCATCTGCCTGG + Intronic
1131159750 15:90097909-90097931 ACTCATGGCAAGGATGGGCTGGG + Intronic
1133388148 16:5387251-5387273 TCTCATTTTCAGAATCTGCTGGG + Intergenic
1135324632 16:21518657-21518679 TCCCATGGCAAGGATCGGCCTGG - Intergenic
1136336119 16:29611927-29611949 TCCCATGGCAAGGATCGGCCTGG - Intergenic
1136633332 16:31502575-31502597 TCTCACGGCCAGCATCAGCTGGG + Intronic
1136895257 16:33992670-33992692 GCTCATGGCCAGGGGCTGCCCGG + Intergenic
1137001778 16:35235377-35235399 GTGCATGGCCAGGAGCTGCTGGG - Intergenic
1137018059 16:35395246-35395268 GTGCATGGCCAGGAGCTGCTGGG - Intergenic
1137765281 16:50973242-50973264 CCTCATCCCCAGGACCTGCTGGG - Intergenic
1138378551 16:56584074-56584096 GGTCCGGGCCAGGATCTGCTTGG + Intergenic
1140225209 16:73071386-73071408 GCTCAAGGCCAGGAGCTGCTGGG - Intergenic
1142384920 16:89757784-89757806 TGTGATGCCCAGGATCTACTAGG + Intronic
1144228066 17:13171185-13171207 TCTGATGGCCTGGGACTGCTTGG + Intergenic
1145324365 17:21788627-21788649 TCTCCTTCCCATGATCTGCTAGG + Intergenic
1145326243 17:21830182-21830204 TCTCCTTCCCATGATCTGCTAGG - Intergenic
1148911017 17:50942798-50942820 TCTCTTGTCCAGTATCTGCCAGG + Intergenic
1149637313 17:58181238-58181260 TTCCATGGCCAGCATCTCCTGGG + Intergenic
1150573887 17:66412872-66412894 TCTAATGGCTGGTATCTGCTGGG - Intronic
1152064040 17:78100293-78100315 TCTCATGGACAACCTCTGCTAGG - Intronic
1152473286 17:80502209-80502231 ACTCATAGCCAGGAGCGGCTTGG + Intergenic
1152597580 17:81245538-81245560 CCTCATGGCCAGCAGGTGCTAGG + Exonic
1153101844 18:1480539-1480561 TGTCAAGGCCAGGACCTGGTGGG - Intergenic
1153599581 18:6766581-6766603 TCTGATGGGCAGTTTCTGCTGGG + Intronic
1155532121 18:26777784-26777806 TCTCATGGCCAGGAGCTTTTTGG - Intergenic
1156483733 18:37451864-37451886 TCTCATATCCTGGATCTGATGGG + Intronic
1157033036 18:43936946-43936968 TCCCATGACCAAGATGTGCTCGG + Intergenic
1160100911 18:75918205-75918227 TCTCCTGGCCAGGGTCTGGTGGG + Intergenic
1160224829 18:77004679-77004701 TCTCATTCCCAGTATCTGCAAGG - Intronic
1160270605 18:77379966-77379988 TTTGATGGCCAGGGTCTCCTAGG - Intergenic
1161274981 19:3410878-3410900 CCACATGGCCAGGTTGTGCTGGG + Intronic
1162376911 19:10310316-10310338 TCCCATGTCCAGGCTCTGGTGGG - Exonic
1163711716 19:18851064-18851086 CCCCAAGGCCAGGATCTTCTCGG - Intronic
1164586791 19:29480746-29480768 GCTCCTGGCCTGGCTCTGCTTGG - Intergenic
1165091240 19:33389414-33389436 TCTCCTGCCCAGAAGCTGCTGGG + Intronic
1165437719 19:35805752-35805774 GCTCATGTCCAAGATCTGCAGGG - Intronic
1166617745 19:44266147-44266169 TCTTATGGCCAATAACTGCTGGG - Intronic
1167534551 19:50041437-50041459 TTTAATGGGCAGGATCTGCCAGG - Intronic
1167696638 19:51019125-51019147 TCTCATGGCCAGGATCTGCTGGG + Exonic
1168694006 19:58394986-58395008 TCTCATTTCCAGTACCTGCTGGG - Intergenic
926659802 2:15452303-15452325 TATCATGGCCAGGATGGGCACGG + Intronic
928833905 2:35521029-35521051 TCTTATGGCCAGGAACTCCTTGG - Intergenic
932134685 2:69217994-69218016 TCTCATGGACAGGTTCTTCAGGG + Intronic
932399976 2:71473641-71473663 TCTACTGGCCAGTATCGGCTTGG - Intronic
935054976 2:99557796-99557818 TCTAATGGCCAGGCTGTGCTGGG - Intronic
935481450 2:103594937-103594959 TCTCATGGAAAGCCTCTGCTAGG + Intergenic
936293470 2:111247000-111247022 TCTCATGGAGAGGACCTGCCAGG - Intergenic
937015680 2:118603146-118603168 TTTCATGGCCAGGAACTTTTTGG - Intergenic
942376658 2:175344289-175344311 CCGCTTGGCCAGGATCTACTGGG - Intergenic
943238049 2:185347831-185347853 TCTCATGGGGAGCCTCTGCTAGG + Intergenic
944180652 2:196889231-196889253 TCTCAAGGCCAGAATCTGCCAGG + Intronic
945643520 2:212461077-212461099 TCTCATAGACACCATCTGCTAGG + Intronic
947379169 2:229528483-229528505 TATCATCCCCAGGATCTGATAGG + Intronic
947533286 2:230926030-230926052 TCTCATGCCCTGGAGGTGCTGGG + Intronic
947904376 2:233749674-233749696 TGTCAAGGACAGGATCTGGTGGG + Intronic
948478667 2:238237358-238237380 CCTGGTGGCCAGGACCTGCTTGG + Intergenic
948598238 2:239094180-239094202 CATGATGGCCCGGATCTGCTCGG + Intronic
1169944537 20:10974720-10974742 TCCCATGGGCAGGAACTGCCAGG - Intergenic
1170457254 20:16544661-16544683 TCTCCTAGCCAGTATCTTCTGGG + Intronic
1171785628 20:29461917-29461939 ACTAATGGCCAGAATCTGCAAGG + Intergenic
1173351940 20:42253425-42253447 TCTCATGGAAAGGATATGCTTGG - Intronic
1175891179 20:62316720-62316742 GCTGTTGGCCAGGAGCTGCTGGG + Exonic
1177496132 21:21894677-21894699 CCTCATAGCCAGCCTCTGCTAGG - Intergenic
1179475561 21:41641300-41641322 TTGCATGGCCAGAATGTGCTGGG + Intergenic
1180057871 21:45368181-45368203 TCTCCTGGCAGGGATCTGCTGGG + Intergenic
1180102926 21:45598293-45598315 GCTCATGGCAAGGAGCTGCGTGG + Intergenic
1180186935 21:46144770-46144792 TCTCCTGGGCTGGAACTGCTTGG + Intronic
1181345391 22:22216401-22216423 TCCCCTGGCCAGGCTCTCCTAGG - Intergenic
1181489031 22:23249962-23249984 TCTCACGGCCAGACTCTGCTGGG - Intronic
1181842247 22:25673932-25673954 TCACATGGCCTGCATCTGTTGGG + Intronic
1182644926 22:31800513-31800535 TCTCATGGTCAGGAACTGGAAGG + Intronic
1183256250 22:36764265-36764287 TGTCTGGGCCAGGCTCTGCTGGG + Intronic
1183583743 22:38740273-38740295 CCGCACGGCCTGGATCTGCTGGG + Exonic
1183753087 22:39733330-39733352 TCCCACTGCCAGGAGCTGCTGGG - Intergenic
1184179623 22:42811680-42811702 TCTGAAGGCCAGGCTCTCCTGGG - Intronic
1184355096 22:43974495-43974517 TCTCATGGCCTTGGTCTGCAAGG - Intronic
1184729658 22:46365595-46365617 CCTCATGCCCAGGAGCTGCAAGG - Exonic
1185122805 22:48982631-48982653 TCCCATGGGCAGGCTCTGCCAGG + Intergenic
951865152 3:27299452-27299474 TCTCATGGAGAACATCTGCTAGG + Intronic
951995757 3:28726633-28726655 TCTCATTGTCAGGCTCAGCTAGG - Intergenic
953265268 3:41380929-41380951 TCTCATGCCCCTGAGCTGCTGGG + Intronic
956551220 3:70461752-70461774 TCTCATGGACAACCTCTGCTAGG + Intergenic
959466434 3:106693025-106693047 TCTCAGGGCCAGGAACTCATTGG + Intergenic
961639468 3:128355972-128355994 GCTCAGGGCCAGGCCCTGCTGGG + Intronic
964088236 3:152844359-152844381 TATCAAGGCCAGTATCTCCTGGG - Intergenic
964801920 3:160566089-160566111 TCTGGGGGCCAGGACCTGCTGGG + Intergenic
964829676 3:160870086-160870108 TCCCATGGTCAGGATCTGGAAGG - Intronic
965031202 3:163370293-163370315 TGTCATGGCAAGGACCTGGTGGG - Intergenic
965082163 3:164048168-164048190 TCACATGGCTAGGATTTGCATGG - Intergenic
965189170 3:165506368-165506390 CCTCATGGAGAGGCTCTGCTAGG - Intergenic
966083890 3:176042812-176042834 TCTCAAGTCCAAGATTTGCTAGG + Intergenic
969296392 4:6272553-6272575 TCCCAGGGCCAGGACCTCCTGGG + Intronic
969508833 4:7605619-7605641 TCCCATGGGAAGGATCTGCATGG + Intronic
970393287 4:15638870-15638892 GCGCCTGGCCAGGATCTTCTTGG - Intronic
971130623 4:23805537-23805559 TCTGACTGCCAGGATGTGCTCGG - Intronic
972756935 4:42057276-42057298 TCTCATGGACAACCTCTGCTAGG - Intronic
977022160 4:91772186-91772208 TCTCATGGAGAGCCTCTGCTAGG - Intergenic
977189148 4:93977963-93977985 TCTCATGGAGAACATCTGCTAGG + Intergenic
977970931 4:103213360-103213382 GCTAAAGCCCAGGATCTGCTGGG + Intergenic
979063560 4:116098468-116098490 TCTCATGGACAACCTCTGCTAGG + Intergenic
979529521 4:121754298-121754320 TCTAATATCCAGGATCTGCAAGG + Intergenic
981061709 4:140431965-140431987 TCTCATGGAGAAGCTCTGCTAGG + Intergenic
982276279 4:153639846-153639868 TCTTATGGTTAGGATCTGGTGGG + Intergenic
983181081 4:164649815-164649837 TCACATGGCCAGGTACTCCTTGG + Intergenic
983517672 4:168674602-168674624 TCTCCTGGCCCGCATCTGATTGG - Intronic
983660464 4:170126318-170126340 TCTCATGGAGAGCCTCTGCTAGG + Intergenic
984547304 4:181121927-181121949 CTTCAAGGCCAGGAGCTGCTGGG + Intergenic
985063611 4:186101624-186101646 TTTCAAGGCCAGGATCTGGAAGG + Intergenic
985585266 5:729159-729181 CCTCATGGCTCGGAGCTGCTTGG - Intronic
985592702 5:773783-773805 CCCCAGGGCCAGGACCTGCTTGG + Intergenic
985598777 5:813486-813508 CCTCATGGCTCGGAGCTGCTTGG - Intronic
985832909 5:2249221-2249243 TCACATGGGCTGGATCTGCAGGG - Intergenic
986211276 5:5675194-5675216 TCTCATGCCCACGGTCTACTGGG - Intergenic
988715574 5:33824069-33824091 GCTCATGACCATGATATGCTTGG - Intronic
988809196 5:34767889-34767911 TCTCATGGAGAGCCTCTGCTAGG + Intronic
990662312 5:58029816-58029838 ACTCATGTCCAGTATCTGTTGGG - Intergenic
992411561 5:76510559-76510581 TCTCATGGACACGATCTGGAAGG + Intronic
992712187 5:79470393-79470415 TCTTTTGGCCATGATCTGCAGGG - Intronic
996671303 5:126121072-126121094 TCTCATGTCAAGGAGATGCTAGG + Intergenic
997593167 5:135087898-135087920 TCTCCTAGCCAGGCACTGCTGGG - Intronic
1000705533 5:164506060-164506082 TCTCATGGCCTGCATTTGCCCGG - Intergenic
1001922455 5:175611227-175611249 TGTCTTGGCCAGGCTGTGCTGGG - Intergenic
1002575526 5:180171829-180171851 TGTGAGGGCCAGGACCTGCTCGG + Intronic
1003897576 6:10622235-10622257 ACTCATGCCCAGTATATGCTGGG - Intronic
1006735127 6:36267965-36267987 TCTCAGGGCCAGGGACTGGTTGG - Intronic
1007746928 6:44048693-44048715 TCTCCTGGCCAGCATCAGCATGG - Intergenic
1008751577 6:54739949-54739971 TGTCATGGGCAGGACCTGGTAGG + Intergenic
1010519113 6:76810590-76810612 TCTCATGACCAGGTTCTGAAAGG - Intergenic
1010674047 6:78720801-78720823 TCTCATGGAGAGCCTCTGCTAGG + Intergenic
1013342650 6:109230170-109230192 TGGCATGTTCAGGATCTGCTGGG + Intergenic
1014771805 6:125465778-125465800 TCTCATGGACAACCTCTGCTAGG + Intergenic
1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG + Intergenic
1019619217 7:1981502-1981524 TCTCATGGACAGGATCCGATGGG + Intronic
1021612028 7:22466858-22466880 TCTCATGGCCAGCAAGTGCAGGG - Intronic
1022211190 7:28211259-28211281 TGTCATGGGCAGGACCTGGTGGG - Intergenic
1022422541 7:30237444-30237466 GTTCATGGCCTGGCTCTGCTAGG - Intergenic
1022534080 7:31085025-31085047 TCTCCTGCCCAGGCTCTGCCTGG - Intronic
1024287517 7:47772132-47772154 TCTTATAGCAAGGAGCTGCTAGG + Intronic
1024558924 7:50627637-50627659 TCCCTTGGCCTGGAGCTGCTCGG - Intronic
1024814866 7:53256932-53256954 TCTCATGGCGAACCTCTGCTAGG + Intergenic
1025306167 7:57858910-57858932 TCTCCTTCCCATGATCTGCTAGG + Intergenic
1026857131 7:73762345-73762367 TCTCCTGGCCAGGGACTGCTGGG + Intergenic
1028227774 7:88268980-88269002 TCTAATGGGCAGCATTTGCTTGG - Intergenic
1030536903 7:110779157-110779179 TCTTATGGCCAGTTTGTGCTGGG - Intronic
1031833889 7:126658802-126658824 TCATTTGGCCAGGGTCTGCTGGG - Intronic
1037628963 8:20635075-20635097 TCCCATGGCCTGGATCTGTTAGG + Intergenic
1037700443 8:21269319-21269341 TCTCATGGCTGGGATATGATGGG - Intergenic
1038411530 8:27362984-27363006 CCTCATGGCCAGAGTCAGCTGGG + Intronic
1041034255 8:53771947-53771969 TCTCATGTGCTGGATCTGTTGGG - Intronic
1043092992 8:75928369-75928391 TCTCATGGACAACATCTGCTAGG - Intergenic
1043510531 8:80946177-80946199 CCTCATGGACAGCCTCTGCTAGG + Intergenic
1045960857 8:107966236-107966258 GCTCATGGCCAGAATCTACAGGG - Intronic
1047019365 8:120758571-120758593 GCCCATGGACAAGATCTGCTGGG + Intronic
1047370800 8:124254228-124254250 TCTCATGGAGAGGCTCTGATGGG + Intergenic
1047760875 8:127953241-127953263 TATCTTGGCCCCGATCTGCTGGG + Intergenic
1048987891 8:139745072-139745094 CTGCATGGCCAGGACCTGCTGGG + Intronic
1049085747 8:140477354-140477376 TCTCATGGAGAGCCTCTGCTAGG - Intergenic
1049479765 8:142816329-142816351 TCTCACGGCCAGGCTCTGCTCGG - Intergenic
1052220623 9:26017544-26017566 TCTCATGGAGAACATCTGCTAGG - Intergenic
1056244216 9:84678232-84678254 TCCCTTGGCCAGGATCTGGTTGG + Intronic
1056461897 9:86816727-86816749 TCTCCTGGCCAGGGTTTGATGGG - Intergenic
1057160567 9:92885537-92885559 TCTGATGGCCAGGATGTCGTGGG + Intergenic
1058128932 9:101227527-101227549 TCTAATGTCCAGAATCTACTAGG - Intronic
1058370378 9:104259356-104259378 TCTCAGTGACAGGATCTGATGGG + Intergenic
1058929932 9:109709125-109709147 GCTAATGGCCAGGATCTGTTTGG - Intronic
1061597454 9:131641138-131641160 TCCCAGAGCCAGGCTCTGCTTGG - Intronic
1062324416 9:136005321-136005343 TCTCAGGGCCAGCACCTGCCTGG - Intergenic
1062528814 9:136990692-136990714 TCTCATGGGAAGGCTCAGCTGGG + Intergenic
1189520269 X:41759651-41759673 TGTCATGACCAAGATCTGCCAGG - Intronic
1192178545 X:68901035-68901057 TCTCATGCCCACTGTCTGCTAGG - Intergenic
1193519576 X:82512268-82512290 TCTCATGGAGAACATCTGCTAGG - Intergenic
1194542372 X:95190306-95190328 CCTCATGGACAGCATCTGCTAGG - Intergenic
1194649923 X:96502197-96502219 TCTCATACCCAGGATCTGTAAGG - Intergenic
1194850249 X:98860122-98860144 CCTCATGGAGAGCATCTGCTAGG + Intergenic
1194929425 X:99868032-99868054 TCTCATGGAGAGTCTCTGCTAGG + Intergenic
1195470053 X:105220386-105220408 TCTCAAGGCCATGATCGCCTAGG + Exonic
1195732704 X:107982116-107982138 TCTCAAGGCCATGATCGCCTAGG + Exonic
1196314437 X:114206275-114206297 TCTGATGGGCAGTATCTGCCTGG + Intergenic
1197396861 X:125938281-125938303 TCTGATAGCCTGGAACTGCTTGG - Intergenic
1197547040 X:127838282-127838304 TCTCATGGACAACCTCTGCTAGG - Intergenic
1198275484 X:135094865-135094887 TCCCATGGCCAGGAGCTGGCAGG - Intergenic
1198318870 X:135498611-135498633 TCTGATTGCCTGAATCTGCTGGG + Intergenic
1199420362 X:147637277-147637299 TCTCATGGACAGCCTCGGCTAGG + Intergenic
1200810896 Y:7483657-7483679 TCTGATGGTCAGGTTCTGATGGG + Intergenic