ID: 1167696904

View in Genome Browser
Species Human (GRCh38)
Location 19:51020094-51020116
Sequence CTGTGGAAGAGGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1541
Summary {0: 1, 1: 2, 2: 7, 3: 169, 4: 1362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167696898_1167696904 4 Left 1167696898 19:51020067-51020089 CCTAGAGTGACAATGTGAGAAGC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG 0: 1
1: 2
2: 7
3: 169
4: 1362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167696904 Original CRISPR CTGTGGAAGAGGAAGGAGGA AGG Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900145593 1:1157561-1157583 GTGTGGAGCAGGAAGGGGGAAGG + Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
900946852 1:5835674-5835696 CAGTGGTTGAGGCAGGAGGATGG - Intergenic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901447911 1:9319411-9319433 AGGAGGAAGAGGAGGGAGGAAGG - Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
901565063 1:10107235-10107257 GCGAGGAAGAGGAAGGAGAAAGG - Intronic
901636067 1:10670762-10670784 GTGAGGTAGAGGAGGGAGGAGGG - Intronic
901918695 1:12520185-12520207 CTTTGGAAGATGGAGGCGGAAGG + Intergenic
902156048 1:14487419-14487441 CTGGGGATGAGAAAGGAGGTGGG - Intergenic
902513901 1:16979975-16979997 CTGTGGAAGAGGCCAGAGGTGGG - Intronic
902661462 1:17906918-17906940 CTGTGGAGGAGGAGGGAGCTGGG + Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902781916 1:18710463-18710485 CCAGGGACGAGGAAGGAGGAGGG + Intronic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
903305987 1:22413721-22413743 CCAGGGAAGAGGAAGGAGGAAGG - Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903441065 1:23388145-23388167 TGGTGGAAGGGGAAGGAGGGTGG + Intronic
903516904 1:23917182-23917204 CTGTGGGAGACCGAGGAGGAAGG + Intergenic
903571143 1:24306380-24306402 ATGGGGAAGAGAAAGAAGGATGG + Intergenic
903884486 1:26532864-26532886 CTGAGGAAGAGGGAGGAGTGTGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903947397 1:26972329-26972351 TTGGGGAATAGGAAGGAGGCTGG + Intergenic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
904335960 1:29798277-29798299 CTGGGGAAGAGGAGGCAGGGTGG - Intergenic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905315071 1:37077302-37077324 TTGTGGTAGAGGCATGAGGAGGG + Intergenic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
905882960 1:41476447-41476469 TTATGGAAAAGGCAGGAGGAGGG + Intergenic
906406720 1:45548207-45548229 CTGTGGAAGACTAAGAAGGGAGG - Intergenic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
907044975 1:51295050-51295072 CTGTGGCAGAAATAGGAGGAGGG - Intronic
907181480 1:52574052-52574074 CTTTGGAAGGCCAAGGAGGAAGG + Intergenic
907275257 1:53313429-53313451 CTGTGGAGGACGGTGGAGGAAGG - Intronic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
908097871 1:60759281-60759303 CTGTGGTAGAGAGAGGAGAAAGG - Intergenic
908199601 1:61780604-61780626 CTAAGGCAGAGGCAGGAGGAGGG - Intronic
908415789 1:63912041-63912063 CTTTGGAAGACCAAGGTGGAAGG + Intronic
908438525 1:64130653-64130675 CTCCAGAAGAGGAAGGAGGTAGG + Intronic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908874088 1:68649717-68649739 CTGTGAAAGGGAAAGAAGGATGG - Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909733641 1:78929174-78929196 TTTTAGAAGAGTAAGGAGGAAGG - Intronic
910402585 1:86852320-86852342 TGGTGGAAGATGAAGCAGGAGGG + Intergenic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
910567109 1:88656644-88656666 CTGTGGACCAACAAGGAGGAAGG + Intergenic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911151642 1:94602067-94602089 CTGTGGCAGATGCAGCAGGAAGG + Intergenic
911344622 1:96681526-96681548 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
911694910 1:100879253-100879275 CTGTGGAAGAGTAAGTAGCCTGG - Intronic
912058626 1:105636332-105636354 CTGAGGGACAGCAAGGAGGAGGG - Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912347150 1:108974244-108974266 CTTTGGGAGACGAAGGCGGATGG + Intronic
912410595 1:109478305-109478327 GTGTAGAACAGGCAGGAGGAGGG - Intronic
912512846 1:110200233-110200255 CTGTGGAAGAGGGATGAGTAAGG - Exonic
912627374 1:111216652-111216674 CAGTGTAAGAGGAAGGATAATGG - Intronic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
913630017 1:120700845-120700867 CCGTGGTGGAGGCAGGAGGAGGG - Intergenic
914258466 1:145979295-145979317 GTCTGGAAGAGGAGGGAGTATGG - Intergenic
914343731 1:146780880-146780902 CTTTTGATGAGGAAGCAGGAAGG - Intergenic
914560071 1:148808927-148808949 CCGTGGTGGAGGCAGGAGGAGGG + Intronic
914612762 1:149321288-149321310 CCGTGGTGGAGGCAGGAGGAGGG - Intergenic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915395889 1:155583803-155583825 CTGTGGACTAGGAAGCAGGCTGG - Intergenic
915411495 1:155704414-155704436 CTGTGGACTAGGAAGCAGGCTGG - Intronic
915479537 1:156175488-156175510 AGTGGGAAGAGGAAGGAGGAAGG - Intronic
915584434 1:156836611-156836633 CCATGAAAGAGGAGGGAGGAGGG - Intronic
915740322 1:158113962-158113984 CTGGGGGTGAGGAAGGAGGCAGG + Intergenic
915933724 1:160077629-160077651 AAGTGGAAGAGGAAGCATGATGG - Intergenic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
916046005 1:161000349-161000371 CTGTGGAAGAGAAAGACAGAAGG + Intronic
916147987 1:161758687-161758709 CTTTGGAAGACAAAGGAGGGTGG + Intergenic
916409489 1:164531497-164531519 CTTTGGGAGATGAAGGAGGGAGG - Intergenic
916670247 1:167011033-167011055 AAGTGAAAGAGGAAGGGGGAAGG - Intronic
917270365 1:173266102-173266124 GTGTGCAAGAGTAAGAAGGATGG + Intergenic
917315453 1:173720008-173720030 CTTTGGGAGATGGAGGAGGAAGG + Intronic
917359523 1:174160113-174160135 CGGAGGAAGAGGAAGGGCGAGGG - Intronic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
917546869 1:175979180-175979202 TTTTGGGGGAGGAAGGAGGAGGG - Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917754803 1:178088431-178088453 AGGTGGCAGGGGAAGGAGGACGG + Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918044444 1:180933283-180933305 GAGTGTAAGAGGAAGCAGGAAGG + Intronic
918069503 1:181124556-181124578 AGGAGGAAGAGGAACGAGGAAGG - Intergenic
918138863 1:181703035-181703057 GAGAGGCAGAGGAAGGAGGATGG - Intronic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918674208 1:187261552-187261574 CCTTGAATGAGGAAGGAGGATGG + Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
919842552 1:201619759-201619781 ATGAGGAAGAGGCAGGAGGCAGG + Intergenic
919856974 1:201712674-201712696 CTTTGGGAAAGGGAGGAGGAAGG + Intronic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
920093180 1:203468720-203468742 CTGAGGAAGAGTCAGGTGGAGGG + Intergenic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920448594 1:206039471-206039493 ATGAGGAAGAGGATGGAGAAGGG + Intronic
920453333 1:206077526-206077548 CTTTGGGAGGGGAAGGAGGGAGG + Intronic
920494401 1:206444392-206444414 CTGTGGAAGATGAAGAATGTTGG - Intronic
920505770 1:206514168-206514190 TTTTTGGAGAGGAAGGAGGAAGG + Intronic
920508680 1:206534917-206534939 GTTTGGATGAGGAAGGAGGGAGG - Intronic
920703649 1:208236148-208236170 CTGTGGACGGGGAAGGAGCCTGG + Intronic
921185375 1:212665531-212665553 CAGGGGGCGAGGAAGGAGGAGGG - Intergenic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921418390 1:214917388-214917410 CTGTGGAGGAGTAAGAAAGAAGG - Intergenic
922017934 1:221671088-221671110 TTGTGGAAGAGTAAGGATGCTGG - Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922374740 1:224951267-224951289 CTTTGGAAGACCAAGGTGGATGG - Intronic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922486900 1:225980439-225980461 TACTAGAAGAGGAAGGAGGAAGG + Intergenic
922574889 1:226654944-226654966 AGGAGGAAGAGGAGGGAGGAGGG + Intronic
922889277 1:229047803-229047825 CTGTTCAAGAGGAAGGACCAGGG - Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923134536 1:231106630-231106652 GAGAGGGAGAGGAAGGAGGAGGG - Intergenic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
923274030 1:232381108-232381130 CAGTGGAAGACGAGGGAGTAGGG + Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923570042 1:235105265-235105287 CTGTGGGAGAGGAAGGCTGTGGG + Intergenic
923989770 1:239423452-239423474 CTATGGAGGAGGATGGAGGCGGG + Intronic
924250150 1:242124421-242124443 CTTTGGAGGAAGAAGGAGAAGGG + Intronic
924404351 1:243727012-243727034 CTGTTGAAGACCAAGGAGGTGGG - Intronic
924659430 1:246002856-246002878 CTTTGGGAGAGGGAGGTGGAAGG - Intronic
924661008 1:246016701-246016723 CTGTGGAAGAGGGGCCAGGAGGG + Intronic
924728760 1:246693036-246693058 CTTTGGAAGGCCAAGGAGGAAGG - Intergenic
1062839603 10:659858-659880 CTGGGAAAGAGAAAGCAGGAAGG - Intronic
1062876931 10:950017-950039 CTGTGGAAGGCCAAGGAGGGTGG - Intergenic
1063185489 10:3646891-3646913 CCATGCAGGAGGAAGGAGGAAGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063469808 10:6275247-6275269 CTCTGGAAGAGGACAGAGAAGGG - Intergenic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1064007417 10:11709506-11709528 GTGGGGAAGAGAGAGGAGGATGG + Intergenic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1064668280 10:17680648-17680670 CTTTGGGAGATGAAGGTGGAAGG - Intronic
1064714745 10:18165257-18165279 CTGTGGAAGGGCAGAGAGGAGGG + Intronic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067712949 10:48664878-48664900 CTGTGGGACAGGAAGCAGGCAGG - Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1067984865 10:51131623-51131645 CAGTGGAAGATGAATGTGGAAGG + Intronic
1068584403 10:58780598-58780620 CTGTGGAATAGGAATGAAGTGGG + Intronic
1069189839 10:65473306-65473328 CTCTGGATGAGGGAGAAGGAAGG - Intergenic
1069410004 10:68143601-68143623 GGGTGGAAGTGGAAGGAGGGAGG + Intronic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1069712602 10:70499638-70499660 CAGTGGCAGAGGGAGGAGCAGGG - Intronic
1069802583 10:71091242-71091264 CTGAGGGTGAGGAAGGAGGGTGG + Intergenic
1069939031 10:71940812-71940834 TTGGGGAAGAGGAAGGAGAGAGG + Intergenic
1070199151 10:74186282-74186304 CTGTGGAAAGGAAAGGAGAAGGG - Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070782344 10:79145014-79145036 CTGGGCAAGAGGAAGAAAGAAGG - Intronic
1070983092 10:80665965-80665987 ATATGGAAGAGGAAGGAGTGAGG - Intergenic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1072148267 10:92663388-92663410 CTGAGGAACAGAAAGGAAGAAGG - Intergenic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072875030 10:99163417-99163439 CTGAGGAGGTGGAAAGAGGAAGG - Intronic
1073062696 10:100741949-100741971 CCCGGGAAGTGGAAGGAGGAAGG + Intronic
1073200210 10:101729195-101729217 CTGTGAAAGACAAATGAGGAAGG + Intergenic
1073207923 10:101778489-101778511 CTGGGGCAGAGGAAGAAGGGTGG - Intronic
1073268450 10:102242076-102242098 AAGTGGCAGAGGAAGGAGAATGG - Intergenic
1073297506 10:102450124-102450146 GTGGGGAGGAGGAAGGAGGGAGG + Exonic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073597693 10:104817343-104817365 GGGTGGAAGAGGGGGGAGGAGGG - Intronic
1073771300 10:106738543-106738565 CAGTGTGAGAGGAAGGAGGCTGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074078738 10:110151579-110151601 AAGTGGAAGAGGAAGGAGACAGG - Intergenic
1074120067 10:110487529-110487551 CTCTGGCAGAGGGAGGGGGAAGG - Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074213462 10:111360576-111360598 GGGTGGTAGAGGCAGGAGGAAGG - Intergenic
1074524869 10:114254473-114254495 GGGTGGAAGAGGAAGGAATATGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074565838 10:114576974-114576996 CTGGGGAAGAAGAAGCAGGTGGG - Intronic
1074704526 10:116119154-116119176 CTCTGGAAGAGCCAGCAGGAAGG + Intronic
1074827164 10:117222941-117222963 CTGTTGAGAAGGAAGGAGGGAGG - Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1075645218 10:124092470-124092492 GCGGGGAGGAGGAAGGAGGAGGG + Intronic
1075984291 10:126770275-126770297 CTGGGGAAGAGGAAGGAGCCAGG - Intergenic
1076087705 10:127649794-127649816 TTGAGGAAGAGGAAGGGGAACGG - Intergenic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1076426177 10:130369253-130369275 CTGGGGAAGAGGGAGCAGGAGGG + Intergenic
1076574849 10:131457760-131457782 CAGTGGAAGATGAAAGTGGATGG + Intergenic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077025742 11:439158-439180 CTGTGGGACAGGAAGGATGGGGG - Intronic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077318642 11:1930170-1930192 CTGCAGACGAGGAAGGAGGGAGG + Intronic
1077334141 11:1995999-1996021 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1077367206 11:2166059-2166081 CTGTGGAGCAGGGAGGATGAAGG + Intronic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1077904376 11:6518303-6518325 CTTTGGAAGACCAAGGAGGGTGG - Intronic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078649669 11:13177037-13177059 CTGTTGAAGAAGCAGGAGCATGG + Intergenic
1079139534 11:17798859-17798881 CTGTGGATGAGGAAACAGGCTGG + Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1079424669 11:20328705-20328727 AAGAGGAAGAGGAAGAAGGAAGG - Intergenic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079445542 11:20553561-20553583 GGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1079524358 11:21366580-21366602 AAGTGGAAGAGGCAGAAGGATGG - Intronic
1079750846 11:24194844-24194866 CTTTGGAAGGCCAAGGAGGATGG + Intergenic
1079776497 11:24536959-24536981 CTGAGGAAGAGGAAGGCCCAAGG + Intronic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1081294674 11:41370891-41370913 CTGAGGAAGAGAAAGGAGAAGGG - Intronic
1081296552 11:41397249-41397271 AGGTGGAAGAGGAGGCAGGAGGG - Intronic
1081509039 11:43749508-43749530 CAGTGTGAGAGGAAGCAGGAGGG + Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081773938 11:45665327-45665349 CGGAGGAAGAGGAGGGAGGAGGG - Exonic
1081884118 11:46480103-46480125 AAGTGGAAGAGGAAGGCAGAAGG - Intronic
1082262862 11:50090670-50090692 ATGTGGAAGAGGGAGGCAGAAGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082757400 11:57091749-57091771 TTGTTGGTGAGGAAGGAGGAAGG - Intergenic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083249365 11:61455451-61455473 ATGTGGCACACGAAGGAGGAGGG + Intronic
1083253050 11:61480950-61480972 CTGTGGAGGAGGCCGGAGGTTGG + Intronic
1083883796 11:65560913-65560935 GTGGGGAAGAGCCAGGAGGACGG + Intergenic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084368879 11:68724626-68724648 CTGGGGAAGAGAAAACAGGAGGG - Intronic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084790281 11:71471201-71471223 CCGTGGAAGAGGTGGCAGGAAGG + Intronic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1084854163 11:71970415-71970437 CTTTGGAAGACTAAGGTGGAAGG + Intronic
1085013604 11:73158123-73158145 CTTTGGAAGAAGAAGAAGTATGG + Intergenic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085167148 11:74413041-74413063 CTAGGCAAGAGGAAGGGGGAAGG + Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085279614 11:75321279-75321301 CTGAGGAAGAGGTGGGGGGATGG - Intronic
1085328643 11:75628272-75628294 CTGGGGGTGAGGAAGGAGTATGG + Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086114224 11:83230293-83230315 CTTTGGAAGACCAAGGCGGATGG - Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087134829 11:94706134-94706156 CTGGGGAAGTGGAAGCAGGGAGG - Intergenic
1087639254 11:100737891-100737913 CTGAGGAAGAGGAATGAGAGGGG - Intronic
1087931869 11:103987275-103987297 GGGTGGGAAAGGAAGGAGGATGG - Intronic
1088074275 11:105827037-105827059 TTCTGGATGAGGAAGGATGAAGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088136792 11:106565161-106565183 AACTGGAAGAGAAAGGAGGAAGG + Intergenic
1088186945 11:107181094-107181116 CAGAGCTAGAGGAAGGAGGAGGG + Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088620081 11:111672592-111672614 CACTAGAAGAGGAAGGAAGATGG + Intronic
1089094394 11:115906654-115906676 CTGTGGAACAGGGATGAGAAGGG + Intergenic
1089173725 11:116533775-116533797 CTGGGGGAGAGGCAGGAGGCTGG - Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089680587 11:120116917-120116939 CTGTGGGAGAGAAAAGGGGAGGG + Intronic
1089700618 11:120241794-120241816 CTGTGGAAGTGGGAGGGGGTGGG + Intronic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1089943221 11:122440952-122440974 CTGAGGAAGAGCCAGGAGGGGGG - Intergenic
1089977293 11:122743456-122743478 CTCTGGAAGCCGAAGCAGGAGGG - Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090236266 11:125150033-125150055 ATGTTGAAGAGATAGGAGGAGGG - Intergenic
1090417854 11:126552965-126552987 CTGGGGAAGAGGATGTGGGAAGG - Intronic
1090940799 11:131386519-131386541 CTGTGGTGTAGGAAGGAGGCAGG + Intronic
1091252341 11:134154423-134154445 CTGAGGAAGAGGACGCAGGAGGG - Intronic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1202817124 11_KI270721v1_random:51181-51203 CTGTGGATGGGGAAGGAGTGAGG + Intergenic
1091446472 12:546617-546639 GTGTGGAAGAGAGAAGAGGAGGG - Intronic
1091697087 12:2634998-2635020 ATTTGGAAGAGGAACGAGAAGGG + Intronic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1091838823 12:3604826-3604848 CTGTGGCCCAGGCAGGAGGAGGG - Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092049806 12:5460345-5460367 TGGTGGCAGAGGAGGGAGGAGGG - Intronic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092310671 12:7348220-7348242 CTGTGCAAGGGGAAAGAGCATGG + Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092482105 12:8869016-8869038 CTGTGGAAAAGGTAGGAAAAGGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1092930370 12:13309853-13309875 CTATTGGAGGGGAAGGAGGAAGG - Intergenic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093055886 12:14555292-14555314 CTTTGGGAGACCAAGGAGGACGG + Intronic
1093378473 12:18460328-18460350 CTTTGGAAGGCCAAGGAGGACGG + Intronic
1093462745 12:19421099-19421121 CTTTGGAAGACCAAGGTGGAAGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094122122 12:26985916-26985938 CTGAGGCAGAGGCAGGAGAATGG - Intronic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1094729778 12:33161573-33161595 CTGTGGGAGAGGGAGCATGAGGG + Intergenic
1095042584 12:37459112-37459134 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1096139147 12:49227784-49227806 CTGTGGACTAGGATGGCGGAGGG + Intronic
1096168910 12:49450352-49450374 CTGTGGCTGAGGCAGGAGAATGG - Intronic
1096276378 12:50211731-50211753 CTGAGGTACAGGAAGAAGGAGGG + Intronic
1096395664 12:51264390-51264412 CAGGGGCAGAGGAAGGAGCATGG + Intronic
1096408720 12:51362173-51362195 CTGTGGGGGAGGAAGCAGGTTGG - Intronic
1096469889 12:51869327-51869349 TGGGGGAAGAGGAGGGAGGAGGG + Intergenic
1096670530 12:53195843-53195865 CTATGGAATAGGAAGGAGGTAGG + Intronic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1096789480 12:54035910-54035932 CTGGGGAAGAGGGAGCAGGGAGG + Intronic
1096977794 12:55709290-55709312 CACAGGAAGAGGAAGGAGGTAGG - Intronic
1097046854 12:56193380-56193402 GAGTGGAAGAGGAAGGGTGAAGG - Intergenic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097241350 12:57577644-57577666 TAGAGGAAGAGGCAGGAGGAAGG + Intronic
1097821263 12:64131276-64131298 TTGTGGAAGAGGTATGTGGATGG - Intronic
1098040776 12:66352301-66352323 CTGAAGTAGAGGAAGGAGCAGGG + Intronic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098194935 12:67989723-67989745 GGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1098507471 12:71270768-71270790 CTGTTGAAGAGCAGGGAGGAGGG - Intronic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099025469 12:77459688-77459710 CTGTGGACGAGGCTGGGGGAGGG + Intergenic
1100431618 12:94535997-94536019 CTCTCTAAGAGAAAGGAGGATGG + Intergenic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100620939 12:96272242-96272264 CTGTGGAAGAGCAAGATGGCAGG + Intergenic
1101276678 12:103209736-103209758 ATGAGGAAGAGCAAGGCGGAGGG - Intergenic
1101514274 12:105419978-105420000 CTATGAAAGATAAAGGAGGAGGG + Intergenic
1101585739 12:106083984-106084006 GAGAGAAAGAGGAAGGAGGAGGG + Intronic
1101911229 12:108861517-108861539 CGGAGGCAGAGGCAGGAGGATGG - Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102244131 12:111344337-111344359 CTGTGAAACAGGAAGGAACAAGG + Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102866986 12:116382313-116382335 AGAAGGAAGAGGAAGGAGGAGGG + Intergenic
1103035644 12:117654340-117654362 CTGGGGAAGAGAAGGCAGGATGG - Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103200159 12:119081654-119081676 CTGGGGAACAGGATGCAGGAAGG + Intronic
1103437466 12:120937820-120937842 GTGAGGGAGAGGAAGCAGGATGG - Intergenic
1103541964 12:121672486-121672508 CAGTGGAAGAGGGAGGAGCCGGG + Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103939790 12:124495493-124495515 GTGTGGCAGTGGATGGAGGAGGG - Intronic
1104215481 12:126728901-126728923 CTGAGGAAGAGAAAGGAGAGTGG - Intergenic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1104842974 12:131833473-131833495 CTGCGGAAGAGGCTGGAGCAAGG + Intronic
1105575812 13:21650574-21650596 CAGAGAAAGAGGAAGAAGGAGGG - Intergenic
1105731911 13:23226015-23226037 GTGTGGCAGAGGTAGGAGAATGG - Intronic
1106166010 13:27246970-27246992 CAGTGGCTGAGGCAGGAGGATGG + Intergenic
1106458581 13:29948727-29948749 CTGTGGCGGTGGAAGGAGGTGGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1107183356 13:37487718-37487740 AAGTGGAAGATGAAGGAGAAAGG + Intergenic
1108283353 13:48881448-48881470 CTGGAGAAGAGAAAGGAGAATGG + Intergenic
1108346616 13:49552689-49552711 CTGCAGAACAGCAAGGAGGAAGG + Intronic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1109376446 13:61500439-61500461 CTCTGTGAGAGGTAGGAGGATGG - Intergenic
1110093408 13:71484264-71484286 ATGAGGATGAGGCAGGAGGATGG - Intronic
1110277323 13:73654716-73654738 CTCTAGAACAGGGAGGAGGAGGG - Intergenic
1110277970 13:73660996-73661018 CTGTGGGAGAGCACTGAGGATGG + Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111960231 13:94802058-94802080 CTTTGGAAGGCCAAGGAGGAAGG + Intergenic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1112311070 13:98317975-98317997 ATGAGGAAGAGGAAGGAGAGAGG - Intronic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1112926433 13:104680441-104680463 CCTTGGAAGAGGAAAGTGGAAGG - Intergenic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1113072475 13:106434902-106434924 CTTTGGGAGATGAAGGAGGGTGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113556959 13:111244550-111244572 CTCTGGGAGAGAAAGGAGAATGG + Intronic
1113662746 13:112118236-112118258 GTGTGGTAGAGGAGAGAGGACGG + Intergenic
1113673189 13:112188868-112188890 CTGTAGACTAGGAAAGAGGAAGG + Intergenic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114561002 14:23590407-23590429 CTTTGGGAGATGAAGGTGGAAGG + Intergenic
1114586935 14:23824216-23824238 CAGTGTAAGAGGAAGTGGGAGGG - Intergenic
1114587083 14:23825146-23825168 AGGTGTAAGAGGAAGCAGGAGGG + Intergenic
1114730469 14:24987582-24987604 GTGTGGAAGATGAAATAGGATGG - Intronic
1114732493 14:25008258-25008280 CTGTGGGAGATGAAGGTGGGAGG + Intronic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1115507918 14:34110436-34110458 TTCTGGAAGAGAAAGGAGGAGGG - Intronic
1115850937 14:37589470-37589492 CTCTGGAGGAGGTGGGAGGAGGG - Intergenic
1116023538 14:39489105-39489127 ATGTGTTAGAGGAAGGAGGGCGG - Intergenic
1117349305 14:54865677-54865699 GTATGGAAGAGGAAGGAGAACGG + Intronic
1117558622 14:56912077-56912099 GTTAGGAACAGGAAGGAGGAAGG - Intergenic
1117839640 14:59846287-59846309 CTGTAGGTGAGCAAGGAGGAGGG - Intronic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1118201323 14:63676650-63676672 CTTTGGAAGGCCAAGGAGGATGG - Intergenic
1118317895 14:64736927-64736949 CGGGGGAGGAGGAGGGAGGAGGG + Intronic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118807677 14:69251778-69251800 CTGAGGTAGAAGAAAGAGGAAGG + Intergenic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119443777 14:74647309-74647331 CAATGGCAGAGGAAGGAGAAGGG - Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1119996833 14:79262445-79262467 AAGAGGAGGAGGAAGGAGGAAGG + Intronic
1120143589 14:80955514-80955536 CTGTGGAGGAGGCTGGAGAAGGG - Exonic
1120470516 14:84918057-84918079 AGGAGGAGGAGGAAGGAGGAGGG - Intergenic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121153666 14:91663064-91663086 AGGTGGAGGAGGGAGGAGGAAGG - Intronic
1121186691 14:91978601-91978623 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1121413849 14:93765225-93765247 CTCTGGAAGAGAAAGGAAGTAGG - Intronic
1121798918 14:96757215-96757237 AGGGGGAAGAGGATGGAGGAGGG + Intergenic
1121878166 14:97473838-97473860 GTGGGGAAGAGTCAGGAGGAGGG + Intergenic
1122539736 14:102491455-102491477 CTTTGGAAGACTAAGGAGGGAGG - Intronic
1122778784 14:104134936-104134958 CTGTGGGGGAGGGAGGAGGGTGG + Intergenic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1202941115 14_KI270725v1_random:146846-146868 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1123542316 15:21306563-21306585 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1124411900 15:29443704-29443726 CTGAGAAAGAGCAAGCAGGAGGG + Intronic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1124706662 15:31972203-31972225 CTGTGGCAGACGGAGGAGGCTGG + Intergenic
1124899801 15:33811404-33811426 CTGAGGCAGAGGCAGGAGAATGG + Intronic
1125061715 15:35433923-35433945 CTGTGGAAGAGAAAAGAGAAGGG + Intronic
1125069217 15:35531987-35532009 CCATGGAACAGAAAGGAGGAAGG + Intronic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125535814 15:40440904-40440926 CTGGGGACGAGGAAGCAGGAAGG + Intronic
1125542447 15:40477771-40477793 CTGTGGAGGATAAAGGAGAAGGG + Intergenic
1125597440 15:40895886-40895908 CTGTGGAAGAGACAGGTGAAGGG - Intronic
1125912007 15:43448881-43448903 CTTTGGGAGACGAAGGCGGATGG + Intronic
1126283641 15:46986543-46986565 CTGGGGAAGAGAAGGCAGGATGG - Intergenic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126785777 15:52176952-52176974 CTGAGGAAGAGTGAGGAGGCAGG - Intronic
1126962611 15:54014659-54014681 CTATGGCAGAGGAAACAGGAAGG + Exonic
1127185805 15:56479650-56479672 CTGTGGTAGAGTAAGGACGGGGG + Intergenic
1127373580 15:58362297-58362319 CTGTGGAAGATGGAGCAGCAAGG - Intronic
1127483000 15:59394364-59394386 CAGTGGAAGAGCCAGGATGATGG + Intronic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128111887 15:65081708-65081730 CTATGGAAGAGGGAAGAGAAAGG - Intergenic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1128286719 15:66443189-66443211 CTGTGGCTGAGGCAGGAGAATGG - Intronic
1128355752 15:66925293-66925315 CTGAGGAAGAGAGAGAAGGAAGG - Intergenic
1128705119 15:69832593-69832615 AAGTGGAAGAGGAAGGGGAAAGG + Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128714228 15:69895455-69895477 CTGAGCAAGAGGAAGGATGGAGG - Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129039098 15:72670476-72670498 ATGGGGCAGAGGAAGGAGGCGGG + Intergenic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129399610 15:75274326-75274348 ATGGGGCAGAGGAAGGAGGCGGG + Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129717249 15:77859647-77859669 CTGTGGCAGAGGCAGGAGCCTGG + Intergenic
1129897150 15:79117004-79117026 CTGCTGAAGAGGCAGGTGGAAGG + Intergenic
1130118320 15:81024735-81024757 CTGTGGTGGAGGCAGGGGGAAGG + Intronic
1130461785 15:84164652-84164674 CTGTGGCAGAGGCAGGAGCCTGG - Intergenic
1130510652 15:84586471-84586493 GTGAGGAAGAGTAAGGGGGAGGG - Intergenic
1130561686 15:84963926-84963948 CTGTGGAAGAGCCGAGAGGAAGG - Intergenic
1130839303 15:87682744-87682766 CTGTGGCAGAGGGAGGAATAAGG - Intergenic
1131014154 15:89043513-89043535 AGGAGGAAGAGGAGGGAGGAGGG + Intergenic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1131225109 15:90617951-90617973 CTGTGGGAGACCAAGGAGGTGGG + Exonic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131350008 15:91691284-91691306 CTTTGGAAGACCAAGGAGGGCGG + Intergenic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131570061 15:93525359-93525381 CTGAGGAAGAGGCAGCAGTAAGG - Intergenic
1131747874 15:95469221-95469243 GTGGGGATGAGGAAGGAGCACGG + Intergenic
1131781710 15:95866724-95866746 CTGTGGACCAAGCAGGAGGAAGG + Intergenic
1131926597 15:97391237-97391259 TTGTGGAAGAGAAAGTAGGATGG + Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1202950633 15_KI270727v1_random:33704-33726 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133142768 16:3760194-3760216 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1133206468 16:4237173-4237195 CGGAGGCAGAGGCAGGAGGATGG - Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133392643 16:5422404-5422426 CGTAGGGAGAGGAAGGAGGAGGG + Intergenic
1133392851 16:5423083-5423105 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133582615 16:7160827-7160849 AGGAGGAGGAGGAAGGAGGAGGG - Intronic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1134071952 16:11265758-11265780 TTGCGAAAGAGGAATGAGGAAGG + Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134357836 16:13500900-13500922 CTCTGGAAGTTGCAGGAGGATGG + Intergenic
1134479279 16:14603533-14603555 TGGTGGAGGAGGAAGGGGGAAGG - Intronic
1134811601 16:17171902-17171924 CTTTAGGAGAGGAAGGAGGCTGG + Intronic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1135236695 16:20763468-20763490 GTGAGGCAGAGGAAGGAGAATGG + Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135506169 16:23038367-23038389 TTCTGGAAGAGGAAGAAGGAAGG + Intergenic
1135807006 16:25552058-25552080 CTGAGTAGGAGGCAGGAGGATGG - Intergenic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136197960 16:28667017-28667039 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136259027 16:29061039-29061061 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136276285 16:29181070-29181092 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1136289837 16:29264884-29264906 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1137232031 16:46575190-46575212 CTGTGGAAGTGTATGGAGCAAGG + Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137238563 16:46635324-46635346 GTTGGGAACAGGAAGGAGGAAGG + Intergenic
1137306719 16:47207782-47207804 CTGTGGAAGGGGCGGGAGGGTGG - Intronic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1137374556 16:47941598-47941620 TTGCAGAAGAGGAAGGAGTAGGG + Intergenic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137511996 16:49108899-49108921 GTGGGGAGGAGGAAGGATGATGG - Intergenic
1137844563 16:51674579-51674601 AGCTGGAAGAGGCAGGAGGAAGG - Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1137979809 16:53060098-53060120 CTTTGGAAGACCAAGGAGGGAGG + Intronic
1138188559 16:54995898-54995920 CTGTGGGAGAAGTAGGAGGTGGG + Intergenic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1138574270 16:57897544-57897566 CTGGGGCAGAGAAGGGAGGAAGG + Intronic
1138801177 16:60031850-60031872 CTCTGAAAGAGAAAGCAGGAAGG + Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139206745 16:65036418-65036440 CTGTGGAAGAGGAACATGGCAGG - Intronic
1139692921 16:68652482-68652504 TGATGGAAGAGGAGGGAGGAAGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1139835738 16:69837166-69837188 CTTTGGGAGACCAAGGAGGATGG - Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139990261 16:70934454-70934476 CTTTTGATGAGGAAGCAGGAAGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140509052 16:75494456-75494478 CTGTGAAAAAGGGAGGAGAAAGG + Intronic
1141105554 16:81230597-81230619 ATTTGGATGGGGAAGGAGGAGGG - Intergenic
1141137302 16:81474638-81474660 CTGTGGAAGGGGAATGATGGGGG + Intronic
1141172583 16:81700688-81700710 CTGGGGAAGAGGCAGCGGGAAGG + Intronic
1141527101 16:84618430-84618452 GGGAAGAAGAGGAAGGAGGAGGG - Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141877947 16:86839025-86839047 CCGGGCAGGAGGAAGGAGGAAGG + Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142000338 16:87660680-87660702 CTGTGGAAGAGGCAGCTGGTGGG - Intronic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142071235 16:88092194-88092216 CCGGGGAAGAGGAAGGAGCTGGG - Intronic
1142080666 16:88147129-88147151 CCTTGGAAGAGGAAGGCAGAAGG + Intergenic
1142095721 16:88238360-88238382 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1142251465 16:88993827-88993849 GGGAGGAGGAGGAAGGAGGAGGG - Intergenic
1142284366 16:89165719-89165741 GGGTGGAAGAGGGAGCAGGAAGG - Intergenic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142962379 17:3558855-3558877 CTGGGGAGGAGGCAGGAGGCAGG + Intergenic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143118512 17:4593646-4593668 CAGTGGAGGAGAAAGGAGGATGG - Intronic
1143241147 17:5444347-5444369 CAGTGGAAGAGGACAGACGACGG + Exonic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1143861862 17:9897127-9897149 CTGTGGAGTTGGAAGTAGGAGGG - Exonic
1143993614 17:10988128-10988150 GTGTAGAAGAGGAATAAGGAAGG - Intergenic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144196754 17:12902010-12902032 GAAGGGAAGAGGAAGGAGGAGGG - Intronic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144277484 17:13687860-13687882 CTGAGGAAGAGGAAGAAGAGAGG - Intergenic
1144334341 17:14255524-14255546 TTGTAGGAGAGGGAGGAGGAGGG - Intergenic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1144955763 17:19018108-19018130 CTGAGGGAGAGGGTGGAGGAAGG - Intronic
1145846719 17:28044655-28044677 CTGTGGAAGGGAAGAGAGGAAGG - Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146497777 17:33338196-33338218 TTCTGGAAGGGAAAGGAGGATGG + Intronic
1146497792 17:33338279-33338301 CTCTGGAAGGGCAAGGAGAATGG + Intronic
1146657582 17:34644098-34644120 CTGTCCAAGAGGATGGATGAAGG - Intergenic
1146795237 17:35775747-35775769 GGGTGGAAAAGGAAGGAAGAGGG - Intronic
1146910668 17:36646485-36646507 CTGGGGAAGAGGGTGGAAGAGGG + Intergenic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147600115 17:41740098-41740120 CTGTGGGAGAGGATGGAGACCGG + Intergenic
1148073975 17:44925049-44925071 CAGTAGAGGAGGAATGAGGATGG - Intronic
1148299076 17:46530442-46530464 ATCTGGAATAGGAAAGAGGAGGG + Intronic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148507550 17:48139913-48139935 CTCTCGGAAAGGAAGGAGGAGGG - Intronic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148846388 17:50532513-50532535 CTGTTGAAGAGGCAGGGGAAGGG + Intergenic
1149071142 17:52544763-52544785 GTGTGTGAAAGGAAGGAGGATGG - Intergenic
1149206257 17:54252187-54252209 TTAAGGAAGAGGAAGGAAGAAGG + Intergenic
1149291331 17:55220487-55220509 CAGTGGAAAAGTAAAGAGGAAGG - Intergenic
1149387521 17:56156629-56156651 AGGTGGAAAAGGAAGGAGTAAGG + Intronic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1149734024 17:58975391-58975413 CTGTGGAAGGCCAAGGAGGGAGG + Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149952096 17:60999294-60999316 CTTTGGGAGATGAAGGCGGATGG + Intronic
1150041214 17:61863402-61863424 CCCAGGAAGAGGGAGGAGGAAGG - Exonic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150198070 17:63321912-63321934 CTGTGGAAGAGAAGGGTGAAGGG - Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150652917 17:67021613-67021635 CTGTGGAAGAGAAGGTAGGCAGG - Intronic
1150841667 17:68613302-68613324 ATAGGGAAGAGGAAGAAGGAAGG - Intergenic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1150919593 17:69469254-69469276 AAGTGGAAGAGGAAGGTAGAGGG - Intronic
1151226111 17:72649391-72649413 CAGTAGGAGAGGAAGGAGAAAGG + Intronic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151454557 17:74218213-74218235 CAAGGGAGGAGGAAGGAGGAGGG - Intronic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151770729 17:76158920-76158942 CTGTGGCAGAGTAAAGGGGAGGG - Intronic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152000071 17:77639872-77639894 AGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1152044986 17:77929789-77929811 CCCTGGGAGAGGAAGAAGGATGG - Intergenic
1152083563 17:78203778-78203800 CTTTGGAAGGGCAAGGCGGACGG + Intronic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152201091 17:78946747-78946769 GGGCAGAAGAGGAAGGAGGAAGG - Intergenic
1152239680 17:79154895-79154917 CTGTGGAAGAGCAGGGAGGGAGG - Intronic
1152341018 17:79724920-79724942 CTTTGGAAGACGGAGGAGGGTGG + Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152368919 17:79873019-79873041 ATTAGGAAGAGGAAGGAGGTCGG - Intergenic
1152493897 17:80656913-80656935 CGGTGGGAGAGCAAGCAGGAGGG + Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152778547 17:82216418-82216440 CTGTGGCAGAGCAAGGTGGGTGG + Intergenic
1153362593 18:4214220-4214242 CTGAGGAACAGGAAGGTGGCAGG + Intronic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156876466 18:42019913-42019935 CTGGTGGAGAGGAAGTAGGAAGG - Intronic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157826993 18:50821286-50821308 CTCTGGAGGAGGAAGAAAGATGG + Intronic
1158549393 18:58422319-58422341 TTCTGGAAGAAGAATGAGGAAGG - Intergenic
1158962777 18:62600506-62600528 CTGAGGCAGAGGTAGGGGGAGGG + Intergenic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159267262 18:66098427-66098449 TTCTGGAAAAGGAAGTAGGAAGG - Intergenic
1159636546 18:70811400-70811422 CAGTTGTCGAGGAAGGAGGAAGG + Intergenic
1160030839 18:75258165-75258187 CTGTGGAGGAGCACAGAGGAAGG - Intronic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160211274 18:76882188-76882210 CAGAGGAAGAGGTAGAAGGAAGG - Intronic
1160425495 18:78776237-78776259 ATGTGGAGGAGGAAGGAGACTGG + Intergenic
1160448713 18:78947260-78947282 GAGAGGAAGAGGATGGAGGAGGG + Intergenic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1161012694 19:1968080-1968102 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012730 19:1968188-1968210 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012789 19:1968358-1968380 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161344130 19:3759599-3759621 CTCTGGAAGAAGATAGAGGAGGG + Exonic
1161650006 19:5478476-5478498 CTGTGGAAGAGGGAGGCCGCTGG + Intergenic
1161684807 19:5697490-5697512 CTGAGGCAGAGGGAGGAGGGGGG + Intronic
1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG + Intronic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1161989036 19:7673500-7673522 ATGAGGAGGAGGAAGGAGGGAGG - Intergenic
1162139466 19:8577264-8577286 ATCTGGAAGAAGAAAGAGGAGGG - Intronic
1162389377 19:10380226-10380248 GTGGGGACGAGAAAGGAGGAAGG - Intronic
1162659372 19:12157008-12157030 CTGTGCAAGACAAAGGAGCAGGG - Intergenic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163543256 19:17924641-17924663 CTTTGGAAGACCAAGGAGGGAGG - Intergenic
1164378610 19:27711737-27711759 CTGTGGGAGAGGAAGGCTGAGGG + Intergenic
1164561161 19:29293194-29293216 CTGTGGAAGAGGCCACAGGAAGG + Intergenic
1164592609 19:29514496-29514518 CAGGGGATGAGGAAGAAGGAGGG + Intergenic
1164592650 19:29514642-29514664 CAGATGAAGAGGAAGGAGGGGGG + Intergenic
1164607297 19:29609370-29609392 CTGTGGGAGAGCAATGGGGATGG - Intronic
1165257728 19:34589732-34589754 GTGTGGATGATGGAGGAGGAGGG + Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165361669 19:35340802-35340824 CGGGAGAAGAGGAAGCAGGAGGG + Intronic
1165433037 19:35783124-35783146 CTGAGGAGGAGAGAGGAGGAGGG + Intronic
1165690890 19:37862389-37862411 AGGAGGAGGAGGAAGGAGGAGGG + Intergenic
1165705768 19:37975275-37975297 CCGGGGACCAGGAAGGAGGATGG + Intronic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1165951391 19:39475625-39475647 GTGGGGAAGAGGCAGGAGGCAGG + Intronic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167242847 19:48355392-48355414 CTGTGGAAGAGCTTGGAGGCAGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1167357716 19:49014461-49014483 CTGAGGAAGAGGCAGAAAGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1167775472 19:51551815-51551837 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
1168289774 19:55351959-55351981 GGGAGGAGGAGGAAGGAGGAAGG + Intronic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
1168416747 19:56174238-56174260 CTGGGAAGGAGAAAGGAGGAGGG - Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925288964 2:2734026-2734048 CTGGGGTAGAGAAAGGAGGGTGG - Intergenic
925712891 2:6758669-6758691 ATGTGGAAGAGGGAGGCAGAGGG + Intergenic
926148190 2:10409654-10409676 GGGTGGAACAGGAAGGTGGAAGG - Intronic
926266823 2:11330828-11330850 GGGAGGAAGAGGGAGGAGGAGGG + Intronic
926266832 2:11330850-11330872 GGGAGGAAGAGGGAGGAGGAGGG + Intronic
926309801 2:11667282-11667304 TTGTGGAAGGGGAAAGAGGCTGG - Intronic
926453363 2:13034985-13035007 TTGTGGAGTAGGAAGGAAGATGG + Intergenic
927159846 2:20246673-20246695 CAGTGGAAGAGGGTGCAGGAAGG + Intergenic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
928399543 2:30967945-30967967 CTCAGGTAGAGGAAGGAGAAAGG - Intronic
928588749 2:32791371-32791393 ATGTGGAAGAGGAAGGAAAGGGG + Intronic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928849290 2:35723809-35723831 CTTTGGAAGGCGAAGGAGGGAGG - Intergenic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929545906 2:42855145-42855167 GAGTGGAAGAGGCTGGAGGAGGG + Intergenic
929818741 2:45257082-45257104 CTGTGGAAGCGGGAGGAACATGG + Intergenic
929906221 2:46048852-46048874 CTGGGAAGGAGAAAGGAGGAGGG - Intronic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930541228 2:52709363-52709385 CTGTGGCAGAGACAGGAGAATGG + Intergenic
930936634 2:56960616-56960638 GAGTGCATGAGGAAGGAGGAAGG + Intergenic
931044385 2:58334002-58334024 CAATGGAAAAGAAAGGAGGAGGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
932459067 2:71870810-71870832 CTGTGGAAGAGACAAGAGAAAGG + Intergenic
932488307 2:72101050-72101072 ATGTTGAAGAGCAAGGTGGATGG - Intergenic
932498168 2:72157873-72157895 GTGAGGGAGAGGGAGGAGGATGG + Intergenic
932594382 2:73085173-73085195 CTGTGGCAGCGGAAGGAGCTTGG - Intronic
932654132 2:73593745-73593767 CTGTGGCAGAGGTGGGAGGCTGG - Intronic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
932864105 2:75323665-75323687 CTAAGGAAGAGGAGGGAGAAGGG - Intergenic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
932909618 2:75792010-75792032 CTGTGGAAGAAGGAGGACTATGG + Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
934574480 2:95391518-95391540 CAGTAGAAGAGGGAGGAGGCTGG - Intergenic
934655774 2:96116328-96116350 CGGTGGAGGAGGATGTAGGAGGG - Intergenic
934731614 2:96662054-96662076 GTGTGGAAGAAGAAGGGGCATGG + Intergenic
934751752 2:96798296-96798318 TTGTGGAATGGGAAGGAGAAGGG + Intronic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935147859 2:100408469-100408491 CTGAGGTAGTGGTAGGAGGAGGG - Intronic
935386897 2:102509306-102509328 GTGTGGAAGAGGGAGGCAGAAGG - Intronic
935473661 2:103490807-103490829 CTGAGGAAGAGGAAGAAGAGGGG - Intergenic
935501543 2:103846852-103846874 AAGAGGAAGAGGAAGAAGGAAGG + Intergenic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
936395561 2:112125630-112125652 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936600529 2:113890355-113890377 CTGAGGCGGAGGAAGGAAGATGG + Intronic
936918099 2:117660774-117660796 CTGAGGAACAAGAAGGAGGCTGG - Intergenic
936996568 2:118420789-118420811 CTGTGGAAGAGGGAAGAGCATGG + Intergenic
937011468 2:118566554-118566576 ATGTGACAGAGGAAGAAGGAGGG + Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937307328 2:120880452-120880474 CGGGGAAGGAGGAAGGAGGATGG - Intronic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937469726 2:122164836-122164858 CTCTGGAGCAGGAAGCAGGAAGG + Intergenic
937519216 2:122691192-122691214 TTGTGGAAGAGTAAGGAGGCCGG + Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937839408 2:126510829-126510851 CTGTGACTGAGGAAAGAGGAAGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938581346 2:132649162-132649184 CAGTGGCAGAGGAAGCAGGTAGG + Intronic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
939397913 2:141655100-141655122 CTGGGGAGGAGGAAGAGGGACGG + Intronic
939715827 2:145582740-145582762 CTGTGGAAGAGGAAACAACATGG - Intergenic
939728983 2:145757965-145757987 CTGTGCAAGAGGATGGAGTTTGG + Intergenic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
939956963 2:148535279-148535301 CCATGAAGGAGGAAGGAGGAAGG - Intergenic
940230129 2:151442315-151442337 ATTTGGAAGAGCAAGGCGGAGGG - Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941146634 2:161854990-161855012 ATGTGGAAGATGGAGGAGAAAGG + Exonic
941158488 2:162007977-162007999 CGATGGAAGATGAGGGAGGAGGG - Intronic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
941735143 2:168965959-168965981 ATGTGCAAGAGCAAGGAAGAGGG - Intronic
941751686 2:169141307-169141329 CAGAGGAAGAGGGATGAGGATGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942901449 2:181124755-181124777 CTGTGAAGGAGGAAGTAGGGGGG - Intergenic
943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG + Intergenic
943600901 2:189919855-189919877 TAGAGGAAGAGGATGGAGGAGGG - Intronic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
944230029 2:197383227-197383249 CTTTGGAAGACCAAGGTGGAAGG + Intergenic
944404815 2:199371947-199371969 CTGTGAAAAAGAAAGGATGAGGG + Intronic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
944959401 2:204854008-204854030 CAATGGAAGAGCAAGGAGTAGGG + Intronic
945011483 2:205468631-205468653 CTGAGGAAGAGGTAGGGGAATGG + Intronic
945032746 2:205680882-205680904 GGGAGGAAGAGGAAGGAGGGAGG + Intergenic
945141443 2:206690885-206690907 CTGTGGAGGAGGAATGAAGCTGG + Intronic
945184392 2:207124403-207124425 GTCTGCAAGAGGAAGAAGGAGGG + Exonic
945564175 2:211375990-211376012 ATGAGGGAAAGGAAGGAGGATGG + Exonic
946193246 2:218018690-218018712 CTGGGGAACAGGAAGGAGTCTGG + Intergenic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
947103256 2:226644149-226644171 CTGTGGGAGAGAAAGGGAGAGGG - Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947733739 2:232444469-232444491 CTCTGGCCCAGGAAGGAGGAGGG - Intergenic
947859559 2:233348972-233348994 CTGTGGCAGAGGACAGGGGAAGG - Intergenic
948020849 2:234732101-234732123 CTTTGGGAGAGCAAGGTGGACGG - Intergenic
948091951 2:235302225-235302247 AGGAGGAAGAGGGAGGAGGAGGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948756950 2:240165539-240165561 CCTGGGAAGTGGAAGGAGGATGG + Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948914182 2:241022709-241022731 TTCTGGAAGAGGAAGGACAAAGG - Intronic
948924084 2:241082681-241082703 CTGAGGAAGAGAAGAGAGGAAGG - Intronic
948944226 2:241211307-241211329 CGATGGGAGAGGAAGGGGGAGGG - Intronic
949075892 2:242057695-242057717 CTCTGGACGAGGAATGAGGCTGG + Intergenic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169190910 20:3658803-3658825 CTTTGGAGGAAGAAGGAGGCAGG + Intergenic
1169235164 20:3924803-3924825 CTGTGGTACAAGCAGGAGGATGG - Intronic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169345204 20:4823504-4823526 GGGAGGGAGAGGAAGGAGGAGGG - Intronic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1169895886 20:10504523-10504545 TTGTTGTAGAGGAAGTAGGAGGG + Intronic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1170788920 20:19491734-19491756 GAGTGGGAGAGGAAAGAGGAAGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1170884246 20:20325389-20325411 TTGTGGGGGAGGCAGGAGGAAGG - Intronic
1170987687 20:21273614-21273636 CTGGGGGAGAGCATGGAGGAGGG - Intergenic
1171399071 20:24860005-24860027 GTGAGGAAGAGGAACGGGGATGG - Intergenic
1171492538 20:25531654-25531676 CTCACGAAGAGGAAGGAGCAGGG - Intronic
1171537015 20:25902186-25902208 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1171804093 20:29658968-29658990 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1172184618 20:33023604-33023626 GTGGGGCAGAGGAAGGAGGGGGG - Exonic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172428071 20:34869539-34869561 CTGGGCAAGAGGGAGGAGGCAGG + Intronic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1172773460 20:37394596-37394618 CTGGGGAAGAGGAAGAAGCGGGG - Intronic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1173183027 20:40818923-40818945 GGGTGGAAGAGGAGAGAGGATGG - Intergenic
1173183497 20:40821710-40821732 CTGTGGAGGAGAAAGCAGGCAGG + Intergenic
1173531752 20:43775044-43775066 CAGTGGATGTGGAAAGAGGATGG + Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173817103 20:45996760-45996782 CTGTTGTGGAGAAAGGAGGAGGG + Intergenic
1173955028 20:47024982-47025004 CTGAGGAAGAGGAAGAAGATAGG - Intronic
1173965252 20:47107780-47107802 AAGAGGAAGAGGAAGAAGGAAGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174316419 20:49705934-49705956 CTTTGGAAGGCCAAGGAGGACGG + Intronic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1175139905 20:56853239-56853261 CTGTGGGAGACCAAGGAGGGTGG - Intergenic
1175226063 20:57444657-57444679 GTGTGGGAGCGGAAAGAGGATGG + Intergenic
1175320519 20:58084669-58084691 GGGTGGGAGGGGAAGGAGGAAGG - Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1176038854 20:63053718-63053740 CTGTGGAAGATGAAGAGGGCAGG - Intergenic
1176582046 21:8540096-8540118 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177207380 21:18025793-18025815 CCGTGGAAGATGAAGGGAGAAGG - Intronic
1177276909 21:18923742-18923764 CTGTGAAAGTGGAATGAGAATGG - Intergenic
1177606737 21:23389077-23389099 CTGAGGAAGAGTAAGCAGGGTGG + Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1177762682 21:25419723-25419745 CTTTGTTAGAGGAAGCAGGATGG - Intergenic
1177779449 21:25607291-25607313 GCGGGGCAGAGGAAGGAGGAGGG - Intronic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178719815 21:34998413-34998435 CTGAGGAGGAGGATGAAGGATGG - Intronic
1179068665 21:38051385-38051407 CTGTGCAAAAGAAAGGAGGAGGG - Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1179126776 21:38598129-38598151 CTCTAGCACAGGAAGGAGGAGGG + Intronic
1179203522 21:39250004-39250026 TTCTGGAAGAGGAAGCTGGAAGG + Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179422172 21:41245381-41245403 ATGTGGCAGAGGGAGGAGAATGG - Intronic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1180264883 22:10517144-10517166 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1181931337 22:26403943-26403965 AGGAGGAGGAGGAAGGAGGAAGG + Intergenic
1181934169 22:26427814-26427836 TTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1181934176 22:26427837-26427859 TTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1181934251 22:26428113-26428135 TTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1181934258 22:26428136-26428158 CTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1181934265 22:26428159-26428181 TTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182110453 22:27719411-27719433 CAGTGGGAGAGAAAGGAGGGAGG - Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182440444 22:30360666-30360688 CTTTGGAAGACCAAGGAGGGTGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183403968 22:37620852-37620874 CCGTGGAGGAGGAAGGGGAAAGG - Exonic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183578650 22:38708896-38708918 ATGTGGGAGAGGATGGACGAGGG + Exonic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184414145 22:44342356-44342378 CTTTGGAAGAGGAGAAAGGAAGG + Intergenic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
1185266659 22:49907531-49907553 CAGAGGAGGAGGCAGGAGGATGG + Intronic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
950130052 3:10536459-10536481 AGGAGGAGGAGGAAGGAGGAAGG - Intronic
950164026 3:10780150-10780172 AAGTGAGAGAGGAAGGAGGATGG - Intergenic
950466408 3:13157776-13157798 CTGTGGCAGAGGGAGAAGAAAGG + Intergenic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950692790 3:14673583-14673605 CTGTGGAGTAGAAAGGAGAAGGG + Intergenic
950699317 3:14729237-14729259 CTGTGGTAGAGGATGAGGGAAGG + Intronic
950718740 3:14867733-14867755 CAGTGGAAGACAAATGAGGATGG - Intronic
950734873 3:14998766-14998788 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
950799141 3:15535216-15535238 CTGGGGAAGAGAGGGGAGGAGGG + Intergenic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951099366 3:18668848-18668870 AAGTGGAAGAGGAAGGCAGAAGG - Intergenic
951299794 3:20981777-20981799 CTGTGTAAGAGGTTGGAGCAGGG + Intergenic
952488427 3:33840326-33840348 CTGAGGAAGAGGCGGAAGGAGGG + Intronic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
953041119 3:39255733-39255755 CTGTGGTAGAGGGAGCAGTAGGG + Intergenic
953230263 3:41058369-41058391 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
953234803 3:41096799-41096821 CTGTGGAGCAGTAAGGTGGAGGG - Intergenic
953693105 3:45136378-45136400 CTAAGGAAGAAGGAGGAGGATGG + Intronic
953837865 3:46362711-46362733 CTGTGGAGGATGGAGCAGGAGGG - Intergenic
953869656 3:46615391-46615413 GTGTGGAAAATGAAGGAGAAGGG - Intronic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954055113 3:48016694-48016716 CTGTGTTAGAGGAAGGAAGTGGG - Intronic
954135737 3:48581341-48581363 CTGTGGAGGAGGCAAGAGGGAGG + Intronic
954268402 3:49488238-49488260 AGATGGAAGAGGAAGGAGGTGGG - Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954841345 3:53514555-53514577 CTGTGGAAGAGGAAATAAAATGG + Intronic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
956619210 3:71203923-71203945 TCATGGAAAAGGAAGGAGGAAGG + Intronic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957785564 3:84877800-84877822 CTGAGGCTGAGGCAGGAGGATGG + Intergenic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959498588 3:107079168-107079190 CTGGGGCAGAGGAAGGAGGCAGG + Intergenic
959574461 3:107919402-107919424 GCCTGGAAGAGGAAGGAGGAAGG + Intergenic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
960270932 3:115673782-115673804 CAGTGGAGGAGGGAGAAGGATGG + Intronic
960335611 3:116414006-116414028 AGGTGGAAAAGGAAGGAGGCAGG + Intronic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
960404580 3:117244327-117244349 GTATGCATGAGGAAGGAGGAAGG - Intergenic
960884729 3:122382977-122382999 CTCTGTAGGAGGAGGGAGGAGGG - Intronic
960893394 3:122475922-122475944 CTGAGGAGGAGGGAAGAGGAAGG + Intronic
960903310 3:122573395-122573417 CTTTGGCAGAGGCAGGAGTAAGG + Exonic
961064684 3:123865328-123865350 CTGTGGAAGAGACATGAGTATGG - Intronic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961546177 3:127635155-127635177 CTGTGAAGGAGAAAGGAGGCTGG - Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962403163 3:135078634-135078656 CTGTGAAAGAGAGAGGAAGAGGG + Intronic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
963560087 3:146854123-146854145 GTTTGGAAGATGGAGGAGGAGGG + Intergenic
963771752 3:149393302-149393324 CTCTGGCAGAGGAAGTAGCATGG - Intergenic
964247445 3:154669905-154669927 ATGTTGAAGAGGCAGCAGGATGG + Intergenic
965478246 3:169184590-169184612 CTGAGGAAGAGGTAGGAGCTAGG + Intronic
965680188 3:171242310-171242332 ATGAGGAAGAGGAGGAAGGAAGG - Intronic
965774249 3:172211594-172211616 CTGTAGAAGAGGAGGGCTGATGG + Intronic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966218455 3:177527044-177527066 CTGGGGTAGAGGAAGAAGGCTGG - Intergenic
966319462 3:178685020-178685042 GAGTAGAAGAGGAAGGAGGGAGG - Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966437829 3:179908336-179908358 CAGTGGAGGAGAAAGTAGGAAGG + Intronic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
966924439 3:184635236-184635258 GTCGGGAAGAGGGAGGAGGAGGG + Intronic
967831813 3:193926253-193926275 CTGGGGAAGAGAAAGCAGGGTGG - Intergenic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968115424 3:196085668-196085690 CTCATGAAGAGGAAGGATGAAGG + Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969050057 4:4366319-4366341 CGGAGGAAGAGAAAGGAGGCTGG + Intronic
969244674 4:5924665-5924687 CTCTCGGGGAGGAAGGAGGAGGG + Intronic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
969461776 4:7332824-7332846 GTGTGGGTGAGGCAGGAGGAGGG + Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969612510 4:8235334-8235356 GTGTGTGAGAGGAAGGAGGCTGG + Intronic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG + Intergenic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
971661698 4:29426112-29426134 GAGAGGAAGAGGGAGGAGGAAGG - Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
973214076 4:47649194-47649216 CCGTGAAAGAGGCAGGATGAAGG + Intronic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
973721110 4:53724532-53724554 GTGGGGAGGAGGAAGGAGGGAGG - Intronic
973817073 4:54629234-54629256 CTTTGGGAGACCAAGGAGGATGG - Intergenic
973885613 4:55318027-55318049 AGGAGGAAGAGGAAGGAGAAGGG + Intergenic
974297825 4:60025545-60025567 CTGTGGAAGACCAAAGTGGAAGG - Intergenic
974351697 4:60755843-60755865 CAGTGGGGGAGGAAGGAGGTGGG + Intergenic
975504451 4:75122856-75122878 AAGAGGAGGAGGAAGGAGGAAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975714099 4:77189185-77189207 CTGTGGAGGAGGAAACAGGGAGG - Intronic
977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG + Intergenic
977270271 4:94909644-94909666 ATCAGGAAGAGGGAGGAGGAGGG - Intronic
977292831 4:95181763-95181785 CTGTGGGAAAGAAAGAAGGATGG + Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978807694 4:112817998-112818020 GTGTGGAAGAGGCTGGCGGATGG + Intergenic
979076879 4:116282389-116282411 CTTTGGAAGAGGAGGCAGTATGG - Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
980644087 4:135619181-135619203 CTGGAGAAGAGGCAGGAGGTGGG - Intergenic
980986118 4:139696157-139696179 CTGAGGAAGAGGAAGAAGAGGGG + Intronic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981454758 4:144940567-144940589 CGGTAGAATAGGAATGAGGATGG - Intergenic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981616389 4:146648362-146648384 TTGTGGACGAGGAAGGAAGGTGG + Intergenic
981643351 4:146969990-146970012 AAGTGGAAGAGGCATGAGGAGGG + Intergenic
981941497 4:150286410-150286432 CAAAGGATGAGGAAGGAGGAAGG - Intronic
982235633 4:153249089-153249111 GTGGGGAAGAGGAGGGAGTAAGG - Intronic
982346188 4:154362735-154362757 AGGAGGAAGAGGAAGGAGAAGGG - Intronic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
984211369 4:176852746-176852768 CTGAGGAAGAGAAAGGAGTGAGG + Intergenic
984364833 4:178785135-178785157 CTTTTGAAGAAGAAGTAGGAAGG - Intergenic
984620326 4:181944863-181944885 AAGTGGAAGAGGAAGGAGGGAGG - Intergenic
984865281 4:184275499-184275521 CTGTGGAAGAGGCAGAAGTCAGG - Intergenic
985168475 4:187123222-187123244 CTGAGGAGGAGGAAGGAGAGGGG - Intergenic
985333169 4:188863389-188863411 CTGAGGAGGAGGAAGAAGAAGGG - Intergenic
986104211 5:4644290-4644312 CTGCGGAAGCGGCAGCAGGAAGG - Intergenic
986407719 5:7443094-7443116 CTGTGGAAAAGGAAAGATGGAGG - Intronic
986504396 5:8433630-8433652 CTATGGAAGGGGAAGGATGTGGG - Intergenic
986636479 5:9827154-9827176 GACTGGAGGAGGAAGGAGGAAGG - Intergenic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
986682694 5:10248650-10248672 CTGGGGCTGAGGCAGGAGGATGG - Intronic
987043216 5:14082668-14082690 CTGCGGGAGATGAAGTAGGATGG + Intergenic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987266162 5:16257170-16257192 CTGAGGAAGAGGAAGGACTCTGG + Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988964713 5:36404392-36404414 CTAGGGAAGTGGAAGGAGTAGGG - Intergenic
990275522 5:54191957-54191979 GAGTGGGGGAGGAAGGAGGAAGG - Intronic
990489902 5:56294479-56294501 TTGTGGAAGAGAAAGGAGTTGGG + Intergenic
990531665 5:56679989-56680011 CTGTGGAGGAGGAAGAAGAGTGG - Intergenic
990598562 5:57334699-57334721 CTTTGGTAGAGGAAGGTGGCTGG - Intergenic
990881414 5:60543207-60543229 ATGTGGAAGAGGAAGGACACTGG - Intergenic
991050388 5:62266649-62266671 CCTTGGCAGAGGAAGGTGGACGG + Intergenic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992229047 5:74645304-74645326 AGGAGGAAGAGGCAGGAGGATGG - Intronic
992233242 5:74684060-74684082 CTTTGGAAGGCGAAGGAGGGCGG - Intronic
992353683 5:75957134-75957156 CTGAGGAAGAGCAATGATGATGG + Intergenic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
993066512 5:83105382-83105404 CTGGGGCAGAGGAAGGAGATTGG + Intronic
993234686 5:85289304-85289326 GTGGGGAAGAGGAGGAAGGAAGG + Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994157280 5:96518265-96518287 CTGTAGAGGAGGAAGAGGGAAGG - Intergenic
994709972 5:103255331-103255353 CTGAGGAGGAGAAAGGTGGAAGG - Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995402340 5:111757275-111757297 TGGAGGAAGAGGAGGGAGGAGGG + Intronic
995708244 5:115007692-115007714 CTTTGGAAGAGGAAGAAGGCAGG + Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996624149 5:125549660-125549682 ATGTAGAAGAGGTAGAAGGAGGG - Intergenic
996684953 5:126269777-126269799 CTGTGGGAGAGGAATGAAGGTGG + Intergenic
996792872 5:127312093-127312115 CAGTGAGAGAGGAAGGAGCAAGG - Intronic
996823939 5:127660289-127660311 CTCTGGACAAGGAAGGAGGCAGG - Intergenic
997109941 5:131064122-131064144 CTGTGGCAGATGACAGAGGAAGG - Intergenic
997596133 5:135108525-135108547 CCAGGGAAGAGGAAGGAGTAAGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
997846635 5:137292217-137292239 CTCTGGATGAGGGATGAGGAAGG + Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998357347 5:141551204-141551226 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998494462 5:142575498-142575520 CAGAGGAAGAGGAGAGAGGAGGG - Intergenic
998628087 5:143868307-143868329 ATATGGAAGATGAAGGAGTAGGG + Intergenic
998651995 5:144131190-144131212 CTTTGGAAAATGAAGGAAGAAGG + Intergenic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
1000317951 5:160111074-160111096 CTGTGGGAGGGCAAGGAGGGAGG + Intronic
1000380373 5:160623555-160623577 CTTTGGAAGAAAAAAGAGGACGG + Intronic
1000495138 5:161972936-161972958 CTGAGGAAAAGAAAGGAGGCTGG + Intergenic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001352600 5:170983889-170983911 CTGCTGAAGAGGAAGGAAAATGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001566120 5:172700603-172700625 CTGTGGAGGAGTAAGGCGGGAGG - Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002061467 5:176628290-176628312 CTGGGGAGGAGGCAGGAGGGAGG + Intronic
1002100990 5:176857556-176857578 CTCAGGAATAGCAAGGAGGAGGG - Intronic
1002189101 5:177469662-177469684 GGGAGGAGGAGGAAGGAGGAAGG - Intronic
1002429364 5:179194163-179194185 CTGCGGAGGAGGGAGGAGGGAGG + Intronic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003514115 6:6804247-6804269 CTATGGGAGGGGAAGGAGGCAGG + Intergenic
1003561273 6:7182721-7182743 CTGTTGAACAGAAAGAAGGAAGG + Intronic
1004271219 6:14197483-14197505 CTGTGGAAGGGGAAGAAGTGTGG + Intergenic
1004365568 6:15009663-15009685 ACGAGGAAGAGAAAGGAGGACGG - Intergenic
1004375172 6:15084840-15084862 CATTGGGAGAGGATGGAGGATGG + Intergenic
1004518066 6:16337371-16337393 GCCTGGATGAGGAAGGAGGAGGG + Intronic
1004535496 6:16496896-16496918 ATCTGCAAGATGAAGGAGGAGGG - Intronic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1005356988 6:24994571-24994593 CTGTAGAAGAGCAAAGAAGAAGG + Intronic
1005560834 6:27039278-27039300 TTGTGGAAGAGGAAGGTGCCAGG - Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005952315 6:30641161-30641183 GTGAGGAAGAGGAAGGAGTGGGG - Intronic
1005997097 6:30938218-30938240 ATCTGGGAGAGGAAGAAGGAAGG - Intergenic
1006001584 6:30969341-30969363 CTGGGGAAGAGAAAGCAGGGTGG - Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006024451 6:31138307-31138329 CTGTAAAGGAGGAAGGAGAAAGG + Intronic
1006062382 6:31433487-31433509 CTGAGGAAGAGAAAGCAGGGTGG - Intergenic
1006088185 6:31611850-31611872 CTTTGGCAGAGGATCGAGGAAGG - Intergenic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006411737 6:33877858-33877880 CTGGGGGAGAGGCAGGAGAAGGG - Intergenic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006527376 6:34618561-34618583 CCATGGAACAGGAAGGAGGAGGG - Intronic
1006603590 6:35241686-35241708 CTTTGGAGGAGAAAAGAGGAAGG + Intronic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1006929510 6:37679334-37679356 CTGTGGATGCGGGAGGAGGGAGG + Intronic
1006977533 6:38117291-38117313 GTGAGGCAGAGGCAGGAGGATGG - Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007375129 6:41451334-41451356 CTGTGGAAAAGGCAGGAGGGAGG - Intergenic
1007520381 6:42447557-42447579 GTGTGGCTGAGGGAGGAGGAAGG - Intronic
1007806658 6:44455378-44455400 TGGTGGAAGAAAAAGGAGGATGG + Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008863258 6:56176978-56177000 GGGAGGAAGAGGGAGGAGGAAGG + Intronic
1008922592 6:56858208-56858230 CAGAGGGAGAGGAAGCAGGAAGG + Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010123931 6:72411349-72411371 TGATGGAAGAGGAAGGAGGCAGG + Intergenic
1010232216 6:73545106-73545128 AGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1010887421 6:81261880-81261902 GAGGGGAAGAGGAAGGGGGAGGG + Intergenic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1011823444 6:91279142-91279164 CTGGGGAAGAGTGTGGAGGAGGG - Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012415145 6:99005038-99005060 CTCTGGAAGAGCAAGGAGGCTGG - Intergenic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013026031 6:106272559-106272581 GAGTTGTAGAGGAAGGAGGAAGG - Intronic
1013165298 6:107584684-107584706 CAGTGGAAGAGAAAGGAGAGGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015326981 6:131934176-131934198 ATGTACAAGAGGAAGGAGGTGGG + Intergenic
1015497180 6:133893981-133894003 CTCTGTAAGATGAAAGAGGAAGG - Exonic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016272223 6:142302098-142302120 CTGCGGACGAGGAAGCAGGCTGG - Exonic
1016481341 6:144485017-144485039 CTCTGGAGGAGGCAGGAGAATGG - Intronic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016941280 6:149484705-149484727 CCGGGGCAGAGGCAGGAGGAGGG - Intronic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017441506 6:154468321-154468343 CTGTGGGAGATCAAGGAGGGTGG - Intronic
1017608323 6:156156875-156156897 CCATGGAAGACCAAGGAGGAAGG + Intergenic
1017720657 6:157241017-157241039 CTGAGGAAGAGGGTGGAGGGAGG + Intergenic
1017737871 6:157380749-157380771 CTGGGGAGGAGGAAGAAGGGAGG + Intergenic
1017758606 6:157550931-157550953 CCATGGAAGGGGAAGGATGATGG + Intronic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1018038046 6:159898545-159898567 AGGAGGAAGAGGCAGGAGGAGGG - Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018064577 6:160116347-160116369 CAGTGGAAAAGGAAGGATGCAGG + Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018564566 6:165137619-165137641 CAGAGCAAGAGGAAGGAGTAGGG - Intergenic
1018607958 6:165618453-165618475 CTGGAGAAGAGGAAGGCTGATGG - Intronic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019476410 7:1246770-1246792 ATTTGGGAGAGGAAGGAAGATGG + Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019535372 7:1526482-1526504 AGGAGGAAGAGGAAGAAGGAGGG + Intergenic
1019764279 7:2838334-2838356 CTTTGGCTGAGGCAGGAGGATGG + Intronic
1019969141 7:4526131-4526153 CAGGGGAAGAGGAAGAAGAAAGG + Intergenic
1020100841 7:5393605-5393627 CCTGGGAGGAGGAAGGAGGAAGG + Intronic
1020516166 7:9122433-9122455 CTTTGGCAGAGAAAGGAGAAAGG - Intergenic
1021064468 7:16156512-16156534 CTGTGGGAGAGGCAGAAGTATGG - Intronic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022115058 7:27253634-27253656 CTGTGTAAGAGAAAGGAGATGGG + Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022585366 7:31603720-31603742 CTGTGGGAGAGGAAGTAAGGTGG - Intronic
1022591213 7:31665070-31665092 TAGTGAGAGAGGAAGGAGGAAGG - Intergenic
1023058320 7:36307250-36307272 GTTTGGAAGAGGGAGGAGGGAGG - Intergenic
1023121800 7:36916715-36916737 CAGTGTAAGAGGAATGAGGGTGG - Intronic
1023127011 7:36964713-36964735 ATGTGGAGGAGGAAGGAAGTAGG - Intronic
1023458567 7:40368438-40368460 CTTTGGGAGGGCAAGGAGGAGGG - Intronic
1023807536 7:43884267-43884289 AGGTGGAAGAGGAAGCAGCAGGG + Intronic
1024028355 7:45433337-45433359 AGGAGGGAGAGGAAGGAGGAGGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1024586894 7:50849845-50849867 CTCAGGATGAGGAAGAAGGAGGG - Intergenic
1024880364 7:54078851-54078873 CTGTGGAAGAGCAAAGAGGGAGG + Intergenic
1025198673 7:56949331-56949353 GGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1025288475 7:57688889-57688911 CTGTGGAATAGAGAGGTGGAAGG - Intergenic
1025673276 7:63627600-63627622 GGGAGGAGGAGGAAGGAGGAGGG + Intergenic
1025910589 7:65825438-65825460 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026044765 7:66899383-66899405 ATGTGGAAGAGGGAGGCAGAAGG - Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026174443 7:67983829-67983851 CTTTGGGGGAGGAAGGAGGGAGG + Intergenic
1026325668 7:69307074-69307096 CAGTGGCAGAGGAAGAGGGAGGG + Intergenic
1026589794 7:71684768-71684790 CTCTGGAAGCTGAAGCAGGAGGG - Intronic
1026688497 7:72532983-72533005 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026723731 7:72854874-72854896 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026814355 7:73498510-73498532 TTGTGAAAGAGGATGAAGGAAGG - Exonic
1026827795 7:73595200-73595222 CCGTGGAGGGGCAAGGAGGAGGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027056016 7:75050029-75050051 ATGTGCAAGAGGAAGGACAATGG + Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028440172 7:90850597-90850619 CTGTGGAAGAGGGAACAGAAAGG + Intronic
1028534781 7:91880537-91880559 CTTTGGAGGAGGAAGAGGGATGG - Intronic
1028587599 7:92467486-92467508 ATTTGGAAGAGGAAGGATGTGGG + Intergenic
1028610394 7:92703946-92703968 CTGAGGCAGAGTAAGTAGGAAGG - Intronic
1028898226 7:96065689-96065711 CTGTGGGAGAGGAAAGAGCCGGG - Intronic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029284693 7:99457622-99457644 CTGATGAAGAGGAAGCAGGGAGG + Intronic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029551475 7:101239191-101239213 CAGAGGAGGAGGTAGGAGGAAGG + Intergenic
1030161000 7:106508480-106508502 CAGTGGCAGAGGAAGAAGGGGGG + Intergenic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1030902399 7:115140615-115140637 TCGTGGAAGGGGAAGGAGAACGG - Intergenic
1031041162 7:116839782-116839804 ATGAGGAAGAGGAAAGATGAGGG + Intronic
1031083379 7:117279325-117279347 CTGTGGGGGAGGAAGTAGAAAGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031774685 7:125892775-125892797 CTGTGGAAAAAAAAGGAGTAGGG - Intergenic
1032240171 7:130153833-130153855 CTGTGGGGGAGGAAGGAGAGTGG + Intergenic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033025001 7:137763770-137763792 CTCTGGATGAGGAAGGTGTAAGG - Intronic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033291724 7:140090882-140090904 GTGGGGGAGAGGAAGAAGGAGGG - Exonic
1033589515 7:142797630-142797652 CTGGGGAAGAGGGAGGGGGTGGG + Intergenic
1034011937 7:147538406-147538428 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034218813 7:149428800-149428822 CTTAGGAAGAGGCATGAGGAGGG + Intergenic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034378394 7:150666698-150666720 ATGTGGCAGAGGATGGAGTAAGG - Intergenic
1034439661 7:151080333-151080355 CTGTGGGAGAGGGAGGTGGTCGG - Intronic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1034711748 7:153198758-153198780 ATGTGGAAGACTGAGGAGGAAGG - Intergenic
1034817197 7:154182759-154182781 CTCTTGATGAGGAAGCAGGATGG - Intronic
1035284176 7:157795741-157795763 CTGTGGACGAGGCGGGAGGCGGG + Intronic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035814165 8:2520990-2521012 TGGTTGAAGAGGAAGGAAGACGG - Intergenic
1035848519 8:2890781-2890803 TTGAGGAAGAGCAAGGAGGCAGG + Intergenic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1037195103 8:16179334-16179356 TGGAGGAAGAGGATGGAGGAAGG - Intronic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037606250 8:20439861-20439883 CTGTGGAAGAGGAAGAAACATGG - Intergenic
1037665908 8:20969963-20969985 CTGTGGCACAGGAAGGAGAGAGG - Intergenic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1037908100 8:22727315-22727337 GGATGGGAGAGGAAGGAGGATGG + Intronic
1038008057 8:23450979-23451001 ATTTGGAAGATGAAGGAAGAGGG - Intronic
1038040730 8:23722239-23722261 GTGGGGGAGAGGGAGGAGGATGG + Intergenic
1038276847 8:26128271-26128293 AGGTGGAGGAGGAAGGAGGGAGG + Intergenic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1038426926 8:27469677-27469699 CTGGGGTAGAGGAAGGAGCAGGG + Intronic
1038775310 8:30525354-30525376 CGGAGGAGGAGGAAGGAGAAGGG - Intronic
1039261857 8:35780455-35780477 CCGAGGAAAAGGATGGAGGAAGG + Intronic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039568206 8:38565830-38565852 CCCTGGAAGAGAAACGAGGAAGG - Intergenic
1041153290 8:54958060-54958082 CTCTTGAAGGGAAAGGAGGATGG - Intergenic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041466228 8:58160091-58160113 CTAAGGGAGAGGAAGGAGCAAGG - Intronic
1041552077 8:59114096-59114118 CAGTGGAACAGGAAGAAGTAGGG - Intronic
1041846143 8:62331033-62331055 AGGTAGAAGAGGAGGGAGGAAGG - Intronic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1041860949 8:62511651-62511673 CTGTGGTAGAGAAAGCAAGAGGG - Intronic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042621759 8:70714073-70714095 GTGGGGATGAGTAAGGAGGAGGG + Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043202312 8:77385648-77385670 TGGTGGAAGATGAAGGAGAAAGG + Intergenic
1043358048 8:79437040-79437062 AGGTGGGAGAGGAAGGAGGGAGG - Intergenic
1043636506 8:82390784-82390806 TTGTGGAAGAAGAAGAAGGCTGG + Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044591579 8:93917711-93917733 GGGGGGAAGAGGATGGAGGAGGG - Intronic
1044837754 8:96312833-96312855 CTGGGGCAGAGGAAGGAAGTGGG - Intronic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045085405 8:98677535-98677557 AGGAGGAAGAGGAAGGAAGAAGG + Intronic
1045290001 8:100824966-100824988 AGGTGGAAGGGGAAGGATGAAGG - Intergenic
1045737422 8:105313060-105313082 CTGTGGAAGAGGATTGGGAATGG + Intronic
1046305798 8:112365210-112365232 ATATTGAAGAGGAAGGAGGCAGG - Intronic
1047256182 8:123215125-123215147 CTGTGAAAGAGAGAGGAGGGGGG + Intergenic
1047284244 8:123472797-123472819 CTGTGGAAGAGAAAGAGGCAGGG + Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047634770 8:126749006-126749028 CTTTGGAAGAACAAGTAGGAAGG + Intergenic
1047722346 8:127652927-127652949 CTGTGGGCGAGGAAGGAGTCAGG - Intergenic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1047983244 8:130205174-130205196 CTATGTGAGAGGAAGGAAGAAGG - Intronic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048296599 8:133219285-133219307 CTGTGGGAGAGGTCTGAGGAGGG - Intronic
1048345365 8:133571426-133571448 CTTTGGGAGAGGAAGAAGGTCGG - Intronic
1048364929 8:133730254-133730276 CTGCGGAGGAGGGTGGAGGAAGG + Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049276609 8:141723253-141723275 AAGAGGAAGAGGAGGGAGGAAGG - Intergenic
1049346333 8:142141082-142141104 AGGAGGAAGAGGAAGCAGGAGGG - Intergenic
1049391448 8:142373631-142373653 CTGTGTCAGAGGTAGAAGGAGGG - Intronic
1049479968 8:142817942-142817964 CGGTGGACCAGGCAGGAGGAGGG + Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1050139703 9:2504545-2504567 CTGAAGAAGAGGTAGGACGAAGG - Intergenic
1050186949 9:2984703-2984725 CTGTGGGAGAGTGAGGAGGAAGG + Intergenic
1050203486 9:3173894-3173916 TCGTGGAAGGAGAAGGAGGAGGG + Intergenic
1050290469 9:4148875-4148897 CTGTGGAGGAGAGAGGAGAATGG - Intronic
1050330591 9:4541505-4541527 GTGTGAAAGAGGAAAGAGGGAGG + Intronic
1050426660 9:5518362-5518384 CCGTGGAAGGGCAAGGAAGAAGG + Intronic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050549862 9:6739751-6739773 CTTTGGGAGACCAAGGAGGAAGG + Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050874346 9:10615412-10615434 GTGGGGAGGAGGTAGGAGGAAGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1051754713 9:20386314-20386336 ATGTTGAAGAGTAAGGAGAAGGG + Intronic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052069557 9:24065478-24065500 AGGTGGAAGAGAAAGGAGAAAGG + Intergenic
1052072331 9:24096868-24096890 CTTGGGAAGAGGTGGGAGGATGG + Intergenic
1052384235 9:27806017-27806039 GTGTGGAAGAGGAAGAAGTAGGG + Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052691671 9:31822913-31822935 CTGTGCAAGAGCAAAGAGTATGG - Intergenic
1052842125 9:33301055-33301077 CTGAGGAAGAGGATTTAGGAAGG - Intronic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053480545 9:38413430-38413452 GGGAGGAGGAGGAAGGAGGAGGG - Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053751144 9:41256801-41256823 CGGGGGCAGAGGCAGGAGGATGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054256664 9:62821130-62821152 CGGGGGCAGAGGCAGGAGGATGG + Intergenic
1054334646 9:63794482-63794504 CGGGGGCAGAGGCAGGAGGATGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054918705 9:70520460-70520482 CTGTGGAGGAGGATGGGCGAGGG + Intergenic
1054932596 9:70651670-70651692 CTATGCAGGAGGAAGGAGGAAGG - Intronic
1054946886 9:70805180-70805202 GAGAGGCAGAGGAAGGAGGAGGG + Intronic
1055320374 9:75078072-75078094 CTGGGAAAGATGAAGGAGAAAGG + Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055592518 9:77832435-77832457 ACTTGGAAGAGGATGGAGGAAGG + Intronic
1055917913 9:81425665-81425687 CTGTGGTAGAGAAATGATGATGG - Intergenic
1056998444 9:91485466-91485488 CTGAGGAGAAGGAAGGAGTATGG - Intergenic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057298783 9:93864709-93864731 GGGTAGAAAAGGAAGGAGGAGGG - Intergenic
1057507615 9:95648653-95648675 CTCTGGAAGAGTAGGAAGGAGGG - Intergenic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058754365 9:108070658-108070680 CTGTGGACCAGGGAGAAGGATGG + Intergenic
1058877135 9:109254150-109254172 CTCTGGAAGTGTAAGAAGGAAGG - Intronic
1058968596 9:110059598-110059620 CTGTGGATGTGAAAGGAGGTGGG + Intronic
1059392409 9:114007518-114007540 CTGGGTAAGAGGGAGGAGGGAGG - Intronic
1059606604 9:115842086-115842108 CTTTGGATTGGGAAGGAGGACGG + Intergenic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1059687405 9:116650838-116650860 CTGTGGAAGGGGAAAGAACAGGG - Intronic
1059756045 9:117294403-117294425 TTGTTGAAGAGGAGAGAGGAGGG + Intronic
1059838206 9:118181222-118181244 GTGGGGAAGAGGAGGGAGAAAGG - Intergenic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1059970122 9:119658635-119658657 GTATGGAGAAGGAAGGAGGATGG + Intergenic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060409302 9:123389519-123389541 CTGTGGAAGTGGCAGGAGCCAGG - Intronic
1060454101 9:123774009-123774031 CAGTGAAAGAGGAAGGGGAAGGG + Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061116840 9:128618918-128618940 ATGTGGAAGAGGAAGAAGCCTGG + Exonic
1061166493 9:128925734-128925756 GGGTGGAAGAGGAGGCAGGAGGG - Intronic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061251473 9:129428871-129428893 GGGTGGAAGGGGAAGGAGGGTGG - Intergenic
1061423308 9:130483886-130483908 AAGTGGAGGAGTAAGGAGGAAGG - Intronic
1061805879 9:133137617-133137639 CGGGGGAAGAGCGAGGAGGAAGG + Intronic
1062014839 9:134286161-134286183 CAGTAGGCGAGGAAGGAGGATGG - Intergenic
1062038969 9:134395558-134395580 CTCTGGAGGAGAAAGGAGGATGG - Intronic
1062068088 9:134539768-134539790 CTGTGGCCGAGGGAGAAGGATGG + Intergenic
1062068161 9:134540041-134540063 CTGTGGGACAGGGAGGAGGTAGG - Intergenic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062164555 9:135100984-135101006 CCTGGGAAGAGGGAGGAGGAAGG - Intronic
1062167505 9:135115295-135115317 CTTCGGAAGAGGGAGGAGGCCGG + Intronic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062314580 9:135960516-135960538 AAGGGGAAGAGGAAGGAGAAGGG + Intronic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1062572095 9:137190447-137190469 CCTTGGGAGAGGAGGGAGGAGGG + Intergenic
1062683689 9:137799041-137799063 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1062683708 9:137799121-137799143 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1203612064 Un_KI270749v1:18113-18135 CTGTGGAATAGAGAGGTGGAAGG + Intergenic
1185568278 X:1113359-1113381 CTTTGGGAGAGGAAGGCGGCTGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185735848 X:2495652-2495674 CAAGGGAGGAGGAAGGAGGAAGG - Intronic
1185827033 X:3261343-3261365 CTGCAGACCAGGAAGGAGGAAGG + Intergenic
1185928173 X:4170647-4170669 CTGGGGAGGAGGAAGGATGAAGG + Intergenic
1186024536 X:5294896-5294918 CTTTGGGAGAGAAAGGAGGAAGG + Intergenic
1186034469 X:5406131-5406153 AGGAGGAAGATGAAGGAGGAAGG + Intergenic
1186192966 X:7084061-7084083 CTTAGGAAGAGGATGGAGGCCGG - Intronic
1186518900 X:10188156-10188178 CTTTGGCTGAGGCAGGAGGATGG - Intronic
1186561568 X:10618918-10618940 ATGAGGAAAAGGAAGGAGAAGGG - Intronic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187419920 X:19125251-19125273 CTATGGAAGAGGAAAGAGGTTGG + Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188312700 X:28637166-28637188 CTGTGGCACATGAAGGAGGTGGG - Intronic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189110596 X:38286083-38286105 AGGGGGAAGAGGAAGGAGAAGGG - Exonic
1189201654 X:39201435-39201457 GTGTGTAAGAGGAAGTGGGAAGG - Intergenic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189364737 X:40379939-40379961 AGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1189437567 X:41006478-41006500 GTGAGGCAGAGGCAGGAGGATGG - Intergenic
1189498264 X:41529334-41529356 CTGTGCAAGGGCAAGGAGAAAGG + Intronic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190176808 X:48157432-48157454 CTGTTGAAGAGAAATGAGCATGG - Intergenic
1190194484 X:48305339-48305361 CTGTTGAAGAGAAATGAGCATGG + Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190660986 X:52653964-52653986 CTGTTGAAGAGAAATGAGCATGG + Intronic
1190781297 X:53598472-53598494 CTGAGGAGGAGGAAGGAAGTGGG - Intronic
1190789045 X:53682856-53682878 CTGAGGGGGAGGAATGAGGAAGG + Intronic
1190886430 X:54534453-54534475 CTACGGCAGAGGAAGGATGAGGG + Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1192264403 X:69529179-69529201 CTGGGGAAGAGGGAGGAGGCCGG + Intronic
1193168922 X:78314185-78314207 ATGTGGAAGAATTAGGAGGAAGG + Intronic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG + Intronic
1195696219 X:107669582-107669604 TGGGGGAGGAGGAAGGAGGAAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1195923547 X:110003955-110003977 CTGAGGCAGACGAAGGAGGACGG + Exonic
1195934630 X:110113051-110113073 TGGCGGAAAAGGAAGGAGGAAGG - Intronic
1195962129 X:110397144-110397166 CTTTGGAACAAGAAGGAGGCAGG - Intronic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196657333 X:118232206-118232228 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1197280786 X:124533487-124533509 CTCTGGAAGAGGAAACAGGGAGG - Intronic
1197295664 X:124716441-124716463 CAGTGGATGAGGAAGGAGATTGG - Intronic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1197637579 X:128932371-128932393 CTCTGGAAGAAGAAAGAAGAGGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198738754 X:139817632-139817654 CTGTGGAAGATGAATTAGAAGGG + Intronic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1199895915 X:152127753-152127775 TTGGGGAAGAGAATGGAGGAGGG - Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199955681 X:152740551-152740573 TTGGGGAAGAGGATGGAGAAGGG - Intergenic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1200116010 X:153770012-153770034 CCATGGGAGAGGAAGGAGGACGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic
1201646022 Y:16232734-16232756 CTTTGGTAGAGAAAGGAGGCGGG - Intergenic
1201656791 Y:16352579-16352601 CTTTGGTAGAGAAAGGAGGCGGG + Intergenic