ID: 1167698296

View in Genome Browser
Species Human (GRCh38)
Location 19:51027441-51027463
Sequence GCAGCCAGTAAGTGAACAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167698296 Original CRISPR GCAGCCAGTAAGTGAACAGC TGG (reversed) Exonic
901017026 1:6237842-6237864 AAAGCCAGTAAGTGAACAACTGG + Intergenic
901091592 1:6645286-6645308 GCAGCCAGTAATTAAAAAGTGGG + Intronic
903734394 1:25521046-25521068 ACAGCCAATAAGTGGTCAGCTGG - Intergenic
904169536 1:28581832-28581854 GCAGCTAGTAAGTCGACACCGGG + Intergenic
904879401 1:33684037-33684059 CCAGCCAGCAAGTGGGCAGCTGG - Intronic
905167935 1:36094087-36094109 TCAGCCAGGAAGGGCACAGCAGG + Intergenic
905211627 1:36378309-36378331 ACAGCCAGTAAGGGCAGAGCTGG - Intronic
905394528 1:37658338-37658360 ACACCCAGTAAGTGAGGAGCTGG - Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
910292235 1:85610768-85610790 ACATACAGAAAGTGAACAGCTGG + Intergenic
912962289 1:114207043-114207065 GCAGCCAGCTAGTGAGCTGCAGG - Intergenic
913265826 1:117043086-117043108 GCATCCAGTGAGTGAAGACCAGG + Intergenic
915017303 1:152745973-152745995 GCAGCCAGTGTGGTAACAGCGGG - Intronic
919194632 1:194267347-194267369 GCAGTCAGTAAATCAAAAGCTGG + Intergenic
920563192 1:206953842-206953864 GTAGCAAGTAAGTGAGCAGTGGG + Intergenic
922428119 1:225519231-225519253 GCAGTTAGAAAGGGAACAGCTGG - Exonic
922769938 1:228176296-228176318 GAAGCCAGTGGGTGAACAGGAGG - Exonic
923850605 1:237790210-237790232 TCAGCAACTAAGGGAACAGCTGG - Intronic
1062817194 10:509361-509383 GCAACAAGTATGTGAGCAGCTGG + Intronic
1064031159 10:11883949-11883971 AAATCCAGTAAGTGAACAGCTGG + Intergenic
1064468509 10:15611239-15611261 GAAGACAGAAAGTTAACAGCTGG - Intronic
1064973623 10:21090799-21090821 ACAAACAGGAAGTGAACAGCAGG - Intronic
1067655459 10:48188317-48188339 GCAGCCAGAAAGGGAAGAACAGG + Intronic
1067912837 10:50364429-50364451 ACAACCAGAAAGTGAAAAGCAGG - Intronic
1069950656 10:72016092-72016114 GCAGGTAGTAAGTGCCCAGCAGG + Intergenic
1071564886 10:86666690-86666712 GAAGCCAGTCAGAGAGCAGCTGG - Intronic
1073870093 10:107853412-107853434 TCAGCCAGTTAGAGAGCAGCAGG - Intergenic
1076055523 10:127369138-127369160 GAAGCCAGTAATTGAATAGCCGG + Intronic
1076610551 10:131723439-131723461 GCACACAGTTTGTGAACAGCCGG + Intergenic
1077076363 11:704203-704225 CCAGCCAGGAACTGACCAGCTGG - Intronic
1077879139 11:6334238-6334260 GCAGCCAGGATGTGAACATAGGG - Intergenic
1078276781 11:9856185-9856207 GCAGACAGTAACTGAAGGGCTGG + Intronic
1084680658 11:70664419-70664441 GCAGACAGCAGGTGCACAGCAGG - Intronic
1084730474 11:71070106-71070128 GGTGCCAGTAAGTGACCAGGAGG - Intronic
1085063358 11:73469465-73469487 GAAGGCAGGCAGTGAACAGCTGG + Intronic
1085417251 11:76327706-76327728 ACAGCAAGTTAGTGAAGAGCTGG + Intergenic
1087825167 11:102756770-102756792 GCATCCAGTAATTTAGCAGCAGG + Intergenic
1088850286 11:113698566-113698588 GGAGCCAGTGTGTGACCAGCAGG - Intronic
1090263455 11:125339239-125339261 GCAGCCAGTGAGCCAGCAGCAGG - Intronic
1091200670 11:133778118-133778140 CCAGACAGGCAGTGAACAGCAGG - Intergenic
1091399296 12:172801-172823 GTGGTCAGTAAGTGAAAAGCAGG - Intronic
1091704572 12:2685231-2685253 TCACTCAGTAGGTGAACAGCAGG - Intronic
1091706400 12:2696398-2696420 GCAGCCAGTAACTGATCTGAAGG - Intronic
1091711142 12:2741568-2741590 TCACTCAGTAGGTGAACAGCAGG - Intergenic
1093896880 12:24583988-24584010 GCAGCCAGTCATTGAGGAGCCGG + Intergenic
1098511006 12:71314125-71314147 GCAGCCATCAAGTGAACAGTGGG + Intronic
1100245868 12:92756449-92756471 ACTGCCAGTAATTGAAGAGCAGG + Intronic
1100603755 12:96134026-96134048 ACAGCCAGCAAGGGAGCAGCAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102972272 12:117178624-117178646 CCAGACAGTAAAGGAACAGCTGG - Intronic
1104844331 12:131839141-131839163 GCTGCCAGCAACTGCACAGCTGG - Intronic
1108688422 13:52840945-52840967 TCAACTAATAAGTGAACAGCAGG - Intergenic
1110128614 13:71979040-71979062 GCAGCCAGCAAGTGCCCAGAGGG - Intergenic
1112689646 13:101877498-101877520 ATAACCAGTAAGTTAACAGCTGG + Intronic
1113046406 13:106159838-106159860 GCAGGCAGTTGGTGGACAGCGGG + Intergenic
1118997694 14:70851905-70851927 GTAGCCAGTAATGGGACAGCTGG + Intergenic
1119761836 14:77157343-77157365 GCAGCAACAAAGTGAACAGCTGG - Intronic
1120476069 14:84989016-84989038 GCAGCCACCAAGTAAACATCTGG + Intergenic
1125436512 15:39651014-39651036 GCAGCCAGTAACTGGTCAGATGG + Intronic
1125687160 15:41570274-41570296 GCTGCCCGGAAGTGAACGGCTGG - Exonic
1128268209 15:66285699-66285721 ACAGCCAGCAAGAGAACTGCAGG + Intergenic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1130862048 15:87899843-87899865 GCAGCCAGTCAGTGAACAGATGG - Intronic
1131025505 15:89138007-89138029 GAAGCCAGCAGGTCAACAGCAGG - Intronic
1134625254 16:15718590-15718612 ACAGCCAGGAAGTGGACAGCCGG + Intronic
1134863902 16:17587211-17587233 GCAGCCACTAACTCAAAAGCTGG + Intergenic
1135545652 16:23364339-23364361 GAAGCCAGTATCTGAAGAGCTGG + Intronic
1136088591 16:27902857-27902879 GTAGCCAGCAAGTGCCCAGCGGG + Intronic
1140038472 16:71389551-71389573 GCAGCCAGTAAGTGAAAGAGAGG + Intronic
1140441785 16:74993461-74993483 GCAGCTAGTAAGAGCAGAGCTGG - Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1142699461 17:1650207-1650229 GCAGGCAGTTTGTGTACAGCCGG - Intergenic
1143377601 17:6476564-6476586 GCAGCCAGTGACGGAAGAGCTGG - Intronic
1143822366 17:9575326-9575348 CCAGCCAGTTAGTAACCAGCTGG - Intronic
1143962617 17:10733167-10733189 GCAGCCAGGGAGTGTCCAGCAGG - Intergenic
1145405301 17:22585107-22585129 CAAGGCAGGAAGTGAACAGCAGG - Intergenic
1146448649 17:32953984-32954006 GCAGCCAGTAAGGGAAGAACTGG + Intergenic
1147119740 17:38328972-38328994 GCAGAAATTAAGTCAACAGCAGG - Exonic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1148124180 17:45228477-45228499 GAAGCCAGTAAGAGGAGAGCTGG - Intronic
1149015812 17:51907276-51907298 GGAGTAAGCAAGTGAACAGCAGG - Intronic
1149681033 17:58507265-58507287 GCAGCCAGCCAGAGATCAGCTGG - Exonic
1152270115 17:79319578-79319600 GCAGCCAGGATAAGAACAGCTGG - Intronic
1155600817 18:27545003-27545025 GCAGGCAGTATGTGGCCAGCAGG + Intergenic
1156850793 18:41723753-41723775 GGAGCAAGTAAGTGAACAGAGGG + Intergenic
1158027232 18:52914777-52914799 GCAGCCAGCAGGTGAACAGTAGG + Intronic
1158788835 18:60749859-60749881 GGGGCCAGTAACTGAAAAGCAGG - Intergenic
1160935392 19:1592298-1592320 GCAGCCAGTCCCTGAACGGCCGG + Intronic
1162118252 19:8445221-8445243 GCAGGCGGTACGGGAACAGCCGG - Intronic
1165012974 19:32862225-32862247 GAAGCCAGACAGTGAACGGCGGG + Intronic
1167698296 19:51027441-51027463 GCAGCCAGTAAGTGAACAGCTGG - Exonic
925032460 2:661376-661398 GCAGGCAGCGAGTGCACAGCAGG - Intergenic
925664050 2:6234181-6234203 GCAGGCAGTAAGTGCAGAGCCGG + Intergenic
925979676 2:9166728-9166750 GCAGACAGTGAGGCAACAGCAGG + Intergenic
926908856 2:17830603-17830625 GCAGCCAGTGACTGAACGCCTGG - Intergenic
927446124 2:23162972-23162994 GCAGCCAGTAAATGATTGGCAGG + Intergenic
928167378 2:28981078-28981100 GCAGCCAGGAAGTGCATAGCTGG - Intronic
929098014 2:38282235-38282257 ACAGCCAGAAAGTGAACTGCAGG + Intergenic
929338929 2:40788843-40788865 TCTGCCAGTAAGTGCACATCTGG - Intergenic
930049819 2:47206271-47206293 AAAGTCAGAAAGTGAACAGCAGG + Intergenic
932121010 2:69100194-69100216 TCTGCCAGTAAGTGAAAACCAGG - Intronic
935211214 2:100940719-100940741 ACAGCCAGACAGTGAAGAGCTGG + Intronic
936594665 2:113836407-113836429 GTAGCTAGTAAGTGAAGAGCTGG - Intergenic
937537159 2:122904005-122904027 GCAGCCAGTAAGAGAAGTGGAGG - Intergenic
938561780 2:132478893-132478915 ACATCTAGTAACTGAACAGCCGG - Intronic
944037538 2:195313555-195313577 GCAACTACTAAGTAAACAGCTGG + Intergenic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
947433847 2:230055101-230055123 ACAGCCAGTAAGTGTAGAACTGG - Intronic
1170154342 20:13256023-13256045 GCAGCCAGTAGGAGAGCATCAGG + Intronic
1170458661 20:16556332-16556354 GTAGCCAGTTAGTGACCAGTTGG - Intronic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173896202 20:46552554-46552576 GCAGCCAGACAGCTAACAGCAGG - Intergenic
1175259502 20:57665713-57665735 GAAGCCAGTCAGGGAACACCTGG - Intronic
1175461069 20:59152367-59152389 GCAGCGAGTAGGTGGACAGGTGG + Intergenic
1178307147 21:31500268-31500290 GCTGCCTGTCAGTGAAGAGCTGG - Intronic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1181055311 22:20258135-20258157 GCAGCCAGGAAGTGCTCTGCTGG + Intronic
1182119878 22:27779736-27779758 GCTGCCAGAAAGTGAACGCCAGG + Intronic
1183009370 22:34932246-34932268 GCAGCCTGTAAGTGCAGAGCTGG - Intergenic
1183316652 22:37140849-37140871 ACAGCCAGGAAGTACACAGCTGG - Intronic
1183604480 22:38860521-38860543 GCAGCCTGGAAATTAACAGCAGG + Intergenic
949279613 3:2330660-2330682 TCAGCTAGAAAGTGAAGAGCTGG + Intronic
949526320 3:4908214-4908236 ACAGCCAGCTAATGAACAGCTGG + Intergenic
950222890 3:11210042-11210064 CCAGCCAGTAAGGGAAGAGGCGG - Intronic
953939718 3:47082535-47082557 GAAGTCAGTATGTGAACTGCAGG - Intronic
954394692 3:50287334-50287356 GCAGCCATTAAGTTAACAACAGG - Exonic
955424215 3:58770558-58770580 GCAGCCAGATAGTGAAGAGATGG + Intronic
955972599 3:64450777-64450799 GCACCCAGAAGGTGCACAGCAGG - Intergenic
962458012 3:135583030-135583052 GGAGCCAGTCAGGGAAGAGCTGG - Intergenic
963047295 3:141112118-141112140 GGAGCCAGTGAGTGATCAGTGGG - Intronic
965904651 3:173689048-173689070 GCAGCCAGTAAGAGCAGATCTGG - Intronic
967303573 3:188039640-188039662 CCAGCCAGAAAGAGAAAAGCTGG - Intergenic
968810852 4:2799130-2799152 GCAGCCAGCAGGGGTACAGCAGG - Intronic
969947963 4:10804296-10804318 GCAGTCAGTAAGTGAAGGTCTGG + Intergenic
970005410 4:11406142-11406164 GCACCCAGTGAGTGCTCAGCAGG - Intronic
971998288 4:33995232-33995254 CAAGGCAGGAAGTGAACAGCAGG + Intergenic
973926717 4:55746495-55746517 GAAGCAGGTAAGTGAACAGAAGG + Intergenic
978071282 4:104474496-104474518 TCAGCCAGTAAGTTAGCATCTGG - Intronic
981638759 4:146911660-146911682 GCAACCAGTAAGGGACCAGAAGG - Intronic
982990002 4:162262115-162262137 GCAACCAGTGAATCAACAGCAGG + Intergenic
983954063 4:173676549-173676571 GAAGCCAGGCAGTGCACAGCTGG + Intergenic
984400059 4:179251908-179251930 GCAACCTGTGAGGGAACAGCTGG + Intergenic
986927655 5:12777483-12777505 GTAGGAAGTAAGTGAAAAGCAGG + Intergenic
987125882 5:14812339-14812361 GCAGCCAGTGCGTTAACAGGTGG - Intronic
988909699 5:35826854-35826876 GGAGCCACTGACTGAACAGCTGG + Intergenic
989692411 5:44159748-44159770 GAAACAAGTAAGTGAACAGATGG + Intergenic
990890701 5:60646765-60646787 TCAGGCAGTATGTGAACAACAGG - Intronic
995537955 5:113156358-113156380 GCATCCAGAAAGTGACTAGCAGG + Intronic
998405397 5:141871469-141871491 GCAGCCAGGAAGTGAGCAGCTGG - Intronic
999960567 5:156751787-156751809 TCAGCAAGAAAGTGAACAACTGG + Intronic
1001096418 5:168779027-168779049 ACAGCCACCAGGTGAACAGCAGG + Intronic
1001892642 5:175352008-175352030 GCAGCCAGTGAGGGCAGAGCTGG + Intergenic
1008490834 6:52085475-52085497 GCATCCAGGAAGGGACCAGCAGG - Intronic
1011719126 6:90137083-90137105 GAAGCCAGGAAGAGAACAGACGG + Intronic
1014763318 6:125382159-125382181 GCAGCTAGTAAGTAAAAAACTGG - Intergenic
1016884732 6:148948853-148948875 GCAGCCAGTAAATAAAAAACAGG + Intronic
1021581817 7:22162744-22162766 GCAGCCAGGAAGTGAAGGGTTGG + Intronic
1021909307 7:25368490-25368512 TCAACCATTCAGTGAACAGCTGG - Intergenic
1022443009 7:30449062-30449084 GCAGCCAGTAAGTAAATAAATGG + Intronic
1026765119 7:73155290-73155312 TCAGGCCGTAGGTGAACAGCGGG - Intergenic
1027041592 7:74965045-74965067 TCAGGCCGTAGGTGAACAGCGGG - Exonic
1027082050 7:75237324-75237346 TCAGGCCGTAGGTGAACAGCGGG + Intergenic
1034590509 7:152134165-152134187 GCTGCCAGTAACTGAAAGGCAGG - Intergenic
1035258288 7:157646083-157646105 GCATTCAGTCAGTGATCAGCAGG - Intronic
1035533547 8:374366-374388 ACAGCCAGTAAGTGTCTAGCAGG + Intergenic
1036668105 8:10761234-10761256 CCTGCCAGTCAGTGAACAGGTGG + Intronic
1037155023 8:15689350-15689372 CCAGCCACAAGGTGAACAGCTGG - Intronic
1038524057 8:28258140-28258162 GCAGCCAGTAAGGGCGCAGCAGG - Intergenic
1038716485 8:29995828-29995850 CCAGCCTGTAAGTGAACACGAGG + Intergenic
1040748849 8:50680834-50680856 GCAGACAGTAAATGACCCGCAGG + Intronic
1045661322 8:104441009-104441031 GCAGTCACCATGTGAACAGCTGG + Intronic
1047118252 8:121869798-121869820 AAAGCCAGTATGTGAACACCAGG - Intergenic
1048179653 8:132183391-132183413 GCAGCCATTAAGTGGTCACCTGG - Intronic
1049524641 8:143117079-143117101 GCAGAGAGTAAGTGAAAAGCAGG + Intergenic
1052486862 9:29112492-29112514 GCAGCCAGAAATCCAACAGCTGG - Intergenic
1055007846 9:71528911-71528933 GAAGCCAGTAAGTGGAGAACAGG + Intergenic
1060195387 9:121620287-121620309 GAAGCCAGAAAGTAAACAGGTGG - Intronic
1060550287 9:124481730-124481752 CCACCCACTAGGTGAACAGCAGG - Exonic
1061642906 9:131973629-131973651 GCAGCCATCAAGGGAGCAGCCGG + Intronic
1062509910 9:136899219-136899241 GCAGCCAAAAAGTGAGCAGTAGG - Intronic
1186390289 X:9151879-9151901 GCAGTGAGCAAGTGAACAACAGG - Intronic
1187993496 X:24901049-24901071 ACAGCCAGTAGGTATACAGCAGG + Intronic
1188399653 X:29729182-29729204 TCAGCTTGTAAGTGAACATCTGG + Intronic
1191677710 X:63809209-63809231 TCAGCCAGTGAGTTAGCAGCAGG + Intergenic
1193756683 X:85418063-85418085 GTAGCCAGGCAGTGAACAGCAGG - Intergenic