ID: 1167698628

View in Genome Browser
Species Human (GRCh38)
Location 19:51029443-51029465
Sequence GCCCCCAGAATCACCCTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 244}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167698613_1167698628 20 Left 1167698613 19:51029400-51029422 CCCAGGACACCAGACCTTGAAGG 0: 1
1: 1
2: 0
3: 18
4: 175
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698625_1167698628 -9 Left 1167698625 19:51029429-51029451 CCACACACCAGGGGGCCCCCAGA 0: 1
1: 0
2: 4
3: 49
4: 404
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698609_1167698628 30 Left 1167698609 19:51029390-51029412 CCCACAGACCCCCAGGACACCAG 0: 1
1: 0
2: 0
3: 26
4: 305
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698612_1167698628 21 Left 1167698612 19:51029399-51029421 CCCCAGGACACCAGACCTTGAAG 0: 1
1: 1
2: 1
3: 15
4: 182
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698617_1167698628 6 Left 1167698617 19:51029414-51029436 CCTTGAAGGACTCCCCCACACAC 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698616_1167698628 11 Left 1167698616 19:51029409-51029431 CCAGACCTTGAAGGACTCCCCCA 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698611_1167698628 22 Left 1167698611 19:51029398-51029420 CCCCCAGGACACCAGACCTTGAA 0: 1
1: 0
2: 2
3: 13
4: 151
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698615_1167698628 19 Left 1167698615 19:51029401-51029423 CCAGGACACCAGACCTTGAAGGA 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698622_1167698628 -6 Left 1167698622 19:51029426-51029448 CCCCCACACACCAGGGGGCCCCC 0: 1
1: 1
2: 3
3: 32
4: 354
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698623_1167698628 -7 Left 1167698623 19:51029427-51029449 CCCCACACACCAGGGGGCCCCCA 0: 1
1: 1
2: 3
3: 34
4: 307
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698610_1167698628 29 Left 1167698610 19:51029391-51029413 CCACAGACCCCCAGGACACCAGA 0: 1
1: 0
2: 3
3: 33
4: 420
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244
1167698624_1167698628 -8 Left 1167698624 19:51029428-51029450 CCCACACACCAGGGGGCCCCCAG 0: 1
1: 0
2: 2
3: 22
4: 249
Right 1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG 0: 1
1: 0
2: 5
3: 13
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167698628 Original CRISPR GCCCCCAGAATCACCCTGGA AGG Exonic
900014875 1:141156-141178 GCCTCCATAAACACCCTGAAAGG + Intergenic
900045141 1:499765-499787 GCCTCCATAAACACCCTGAAAGG + Intergenic
900067338 1:741495-741517 GCCTCCATAAACACCCTGAAAGG + Intergenic
902078740 1:13806664-13806686 GCCACCATCATCTCCCTGGATGG + Intronic
902336446 1:15757610-15757632 AGCCCCAGAGCCACCCTGGAGGG + Intronic
902471573 1:16650066-16650088 GCCCCCGTAGTCACCCTGGCAGG - Intergenic
902487236 1:16757379-16757401 GCCCCCGTAGTCACCCTGGCAGG + Intronic
902737589 1:18411432-18411454 GCCCCCAAGCTCAGCCTGGAAGG - Intergenic
903018737 1:20378992-20379014 GGCCTCACAATCACCGTGGAAGG + Intergenic
904273202 1:29363773-29363795 GCCTCCAGAGTCAGCCTGGCTGG - Intergenic
904306797 1:29595012-29595034 ATCCCCACAATCACCCTGGGAGG - Intergenic
906613495 1:47219688-47219710 GCCACCAGGATCAGCCAGGAGGG - Exonic
907555761 1:55343127-55343149 GGCCCCAGAATCACAGTGGGAGG - Intergenic
912023597 1:105138591-105138613 ACTCGCAGAATCACCCTGGCCGG - Intergenic
912863155 1:113232763-113232785 GCCCCCAGTACCACCCTGTATGG + Intergenic
913284144 1:117211748-117211770 GCCCCCAGAAGTACCTTGGATGG + Intergenic
915129568 1:153687386-153687408 GCCCCCAGCACCACCCAGTAGGG + Intronic
915594145 1:156886931-156886953 GGGACCAGAATCACCCTGGGTGG - Intergenic
915909957 1:159908761-159908783 GCCCCCAGGTTCTCCCTGCACGG + Intergenic
916755794 1:167769150-167769172 GCCCTCACAACCACCCTGCAAGG - Intronic
917042900 1:170825942-170825964 GCCCTCAGAAACACCCTTCAAGG + Intergenic
921747193 1:218752242-218752264 GTCCCCAGAGACGCCCTGGAAGG - Intergenic
922101946 1:222484269-222484291 GCCTCCATAAACACCCTGAACGG + Intergenic
922263026 1:223959391-223959413 GCCTCCATAAACACCCTGAAAGG + Intergenic
924036224 1:239941167-239941189 GGCCTCACAATCATCCTGGAAGG - Intergenic
924344865 1:243064392-243064414 GCCTCCATAAACACCCTGAAAGG + Intergenic
1063222370 10:3981506-3981528 GCCCCCAGAGAGACCCTGGAAGG + Intergenic
1064223593 10:13462279-13462301 GGCCTCACAATCACCGTGGAAGG + Intronic
1065628533 10:27654661-27654683 GGCCTCACAATCACGCTGGAAGG + Intergenic
1066731468 10:38440683-38440705 GCCTCCATAAACACCCTGAACGG - Intergenic
1069956268 10:72053832-72053854 ACCCCCAGGATCACCCTGGAGGG - Intergenic
1070977182 10:80614683-80614705 GCCCTCAGAACCACACTGCATGG - Intronic
1071524994 10:86353463-86353485 GCCCCCAGAAGCCCTTTGGAGGG + Intronic
1073291927 10:102417349-102417371 GCCCTGAGCATCACCCTGGGAGG + Intronic
1075123337 10:119680369-119680391 GGGCACAGAAGCACCCTGGATGG + Intergenic
1075479119 10:122764321-122764343 GCCCCCACAAAGAACCTGGAGGG + Intergenic
1076971470 11:136256-136278 GCCTCCATAAACACCCTGAAAGG + Intergenic
1077300322 11:1843771-1843793 GACACCAGAATCACCCGAGAGGG - Intergenic
1078540501 11:12209577-12209599 GGCCGCAGGAACACCCTGGAAGG + Exonic
1079341186 11:19612979-19613001 GGCCTCAGAATCATCCCGGAAGG + Intronic
1082262242 11:50085578-50085600 GCCTCCATAAACACCCTGAATGG + Intergenic
1083214700 11:61211082-61211104 GCCCTCAGCATCACCATGAACGG + Exonic
1083217584 11:61229911-61229933 GCCCTCAGCATCACCATGAACGG + Exonic
1083259856 11:61517046-61517068 GCCCCCAGTTCCACTCTGGATGG - Intronic
1084938640 11:72600719-72600741 ACCCCCAGCATGAGCCTGGAAGG - Intronic
1086588230 11:88481091-88481113 GCCCTCATAATCACCCTGTGAGG + Intergenic
1088562939 11:111134320-111134342 GGCCTCACAATCACCTTGGAAGG + Intergenic
1088830495 11:113532332-113532354 GCCCCCAGGAACCCCCAGGAAGG - Intergenic
1090803634 11:130189508-130189530 GCCCCCAGAATCGGTCTGGTTGG + Intronic
1090807122 11:130209654-130209676 TCCCCCGGAATCACCCTGGGCGG - Exonic
1091774412 12:3175103-3175125 GCCCCCAGCCTCGCCCTGCAGGG - Intronic
1092278395 12:7080682-7080704 GCCCCCACTATCCCCCTGGCAGG + Exonic
1092505222 12:9092026-9092048 GCTCCCAGTTTCTCCCTGGAAGG + Intronic
1094207021 12:27851475-27851497 GCCCTGAGAATGACCCTGAATGG + Intergenic
1094474867 12:30833296-30833318 GCCCCCACACCCACGCTGGAAGG + Intergenic
1096404038 12:51329819-51329841 GCCCCCAGAGTCACCCTGCAGGG + Exonic
1098437167 12:70480131-70480153 GACCCCACAATCACGGTGGAAGG - Intergenic
1101650274 12:106671378-106671400 ACCCCCAGAGCCACCCAGGAAGG - Intronic
1102007236 12:109596614-109596636 GCCCCCAGAATAATCCAGAAAGG - Exonic
1102348210 12:112172981-112173003 GCACCAAGAAACAACCTGGAAGG - Intronic
1102973480 12:117189964-117189986 GCCGCCAGCGTCACCCTTGACGG + Intronic
1103030721 12:117610034-117610056 TCGCCCAGATACACCCTGGATGG + Intronic
1103200952 12:119087544-119087566 GTCCCCAGAAACGCGCTGGAGGG + Intronic
1103694545 12:122804146-122804168 GCCCCCAGTTTCTCCCTGCACGG - Intronic
1104172220 12:126292954-126292976 TCCCCCACAATCACAGTGGAAGG + Intergenic
1104789502 12:131472945-131472967 GACCTCAGAATCAACCAGGAAGG + Intergenic
1107727953 13:43318951-43318973 CCCCACAGAGTCAACCTGGAGGG + Intronic
1108301789 13:49084908-49084930 GCCCCCAGAAGCACCGGGGCTGG - Intronic
1111937282 13:94570217-94570239 GCCCCCTGCCTCACCCAGGATGG - Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1114447011 14:22796392-22796414 GCCCCCACCAGCACCCTGAAAGG + Intronic
1114683324 14:24505645-24505667 GCCCCCAGAGTCTCCCTGTAGGG + Exonic
1115157393 14:30356628-30356650 ACCTCCAGAATCACTCCGGAGGG - Intergenic
1117083915 14:52180016-52180038 GGCCCCACAATCATGCTGGAAGG + Intergenic
1118710053 14:68511422-68511444 GCTCCCAGAATCACCCTAGGGGG + Intronic
1121244335 14:92451370-92451392 GCCCCCGGTAACACCCTGGGTGG + Intronic
1121329281 14:93039959-93039981 GCACCCAGAAACCCTCTGGATGG + Intronic
1122437689 14:101711049-101711071 CTCCCCAGAATCACCCTTAATGG - Intergenic
1122812413 14:104295612-104295634 GCGCCCAGCAGCTCCCTGGATGG + Intergenic
1124021716 15:25931504-25931526 GCCCCCTTAATTTCCCTGGAGGG + Intergenic
1127203882 15:56691661-56691683 ACCCCCATAATCTCCCTAGATGG + Intronic
1127770896 15:62229996-62230018 GTCCCAAGAAACACCCTTGAGGG - Intergenic
1128237835 15:66079704-66079726 ACCCCAAGAATGACCCTGTATGG - Intronic
1131465878 15:92654722-92654744 GCCTCCAGAATTACGCTGGAGGG - Intronic
1132673710 16:1113113-1113135 GCCACCAGCAGCACCATGGAAGG - Intergenic
1132713718 16:1280283-1280305 GGTCCCAGCATCACCCTGTATGG + Intergenic
1133178602 16:4035448-4035470 GCACCCATAATCACTCTGTATGG - Intronic
1134212667 16:12290831-12290853 GCTTCCAGAATCACCATGGCAGG - Intronic
1134246836 16:12546364-12546386 GGCCTCACAATCACCGTGGAAGG + Intronic
1134402349 16:13921055-13921077 GCCCCCAGAAACTCCCTTAATGG - Intronic
1139705533 16:68738090-68738112 GCCCCCAGGAACTCCCGGGAGGG - Intronic
1139941812 16:70610937-70610959 GCCCCCAAAATCACAAAGGATGG - Intronic
1141033948 16:80612164-80612186 GCCAGAAGCATCACCCTGGAGGG - Intronic
1141350511 16:83290517-83290539 GGCCTCACAATCACCGTGGAAGG - Intronic
1141480236 16:84301570-84301592 ACCCCCAGCAGCACCCAGGAGGG + Intronic
1141618561 16:85224074-85224096 GCCCCCAGAATCGCCAAGGGAGG - Intergenic
1141828234 16:86495639-86495661 GCCCCCAGGCTGACCCTTGATGG + Intergenic
1142458706 17:74023-74045 GCCTCCATAAACACCCTGAAAGG + Intergenic
1142599654 17:1047402-1047424 GCCCTCAGAGCCACCGTGGATGG - Intronic
1142811821 17:2399153-2399175 CCCCCCAGAATCCCCCGGCAGGG - Intronic
1144658606 17:17053681-17053703 GCCCACAAAATCACAGTGGAAGG - Intronic
1144830501 17:18128423-18128445 GCCCCCAGGATCACCTTGCTGGG - Intronic
1146159221 17:30550927-30550949 GCCCCCAGCCTCTCCCAGGAAGG + Intergenic
1150382842 17:64734204-64734226 CTCCCCAGGAACACCCTGGAGGG - Intergenic
1150435219 17:65148634-65148656 GCCAACAGAATCTCCCTAGATGG - Intronic
1150773326 17:68059940-68059962 CTCCCCAGGAACACCCTGGAGGG + Intergenic
1152506833 17:80755047-80755069 GCCCCCAGGGACACCCTGGGAGG + Intronic
1152663403 17:81553237-81553259 GCCCCTAGATTCTCCCTCGAGGG - Intronic
1152898278 17:82925942-82925964 GCCCCCAGTACAACCCAGGAAGG - Intronic
1152898297 17:82926000-82926022 GCCCCCAGTACAACCCAGGAAGG - Intronic
1152898316 17:82926058-82926080 GCCCCCAGTACAACCCAGGAAGG - Intronic
1152898355 17:82926174-82926196 GCCCCCAGTACAACCCAGGAAGG - Intronic
1153071039 18:1104881-1104903 GCCCCCACAATAAACCTAGAAGG - Intergenic
1154171239 18:12052738-12052760 GCCACCACAATCACTCAGGAGGG + Intergenic
1155874220 18:31064968-31064990 GCCCCCAGACACACACTGCATGG + Exonic
1157916033 18:51664678-51664700 GGCGCCAGAATCACCAGGGAGGG - Intergenic
1159059077 18:63495538-63495560 GACCCCAGAGCCAGCCTGGAAGG + Intronic
1160648424 19:206536-206558 GCCTCCATAAACACCCTGAAAGG + Intergenic
1160682012 19:416192-416214 GCCCCCAGCATGGCCCTAGATGG - Intergenic
1160682344 19:417648-417670 GACCCCAGAAATAACCTGGAAGG - Intronic
1160923160 19:1529901-1529923 ACCCCCAGAAATACCCAGGAGGG - Intronic
1161421237 19:4176953-4176975 GCCCCCAGATCCCCCCAGGAGGG + Intronic
1161769659 19:6224314-6224336 GCCCCCAGAATCCCCCCAGCTGG + Intronic
1161925015 19:7293778-7293800 GCCCCCAGACTCACCCTCTCCGG + Exonic
1162140144 19:8580635-8580657 CTCCCCAGACCCACCCTGGAGGG + Exonic
1162784511 19:13025856-13025878 GCCCCCAGAATTATCCATGATGG + Intronic
1162823405 19:13236725-13236747 GCCCCCAGGACCTCCCTGGGTGG + Intronic
1162922850 19:13913557-13913579 GAGCCCAGGGTCACCCTGGAGGG + Exonic
1163230977 19:16001985-16002007 GCCCCAAGTCTCACCCTGAAGGG - Intergenic
1164147111 19:22518855-22518877 GCCCCTAGAATTGCCCTGGCAGG - Intronic
1165153533 19:33774352-33774374 ACCCACAGAATGACCCAGGAGGG - Intergenic
1166083184 19:40458000-40458022 GTCCCCAGCATCACCCAGTAAGG + Intronic
1166355898 19:42227104-42227126 GCCCCCAGCATCACCCAGTATGG - Exonic
1167666575 19:50825934-50825956 TCCCCCAGAGTCACCCTGTGGGG + Exonic
1167689696 19:50977677-50977699 TCCCCCTGAGTCACCCTAGAGGG + Exonic
1167698628 19:51029443-51029465 GCCCCCAGAATCACCCTGGAAGG + Exonic
1167705316 19:51078145-51078167 TCCCCCAGAGTCACCCTGAGGGG + Exonic
1167753455 19:51394891-51394913 GACCCCAGAATCTCCAGGGACGG - Intergenic
1168123872 19:54272112-54272134 GCCCCCAAAACCACTCAGGAGGG - Intronic
1168178487 19:54643423-54643445 GCCCCCAAAACCACTCAGGAGGG + Intronic
1168262459 19:55203871-55203893 GACACCAGAGTCACCGTGGATGG - Exonic
1202703971 1_KI270713v1_random:6861-6883 GCCCCCGTAGTCACCCTGGCAGG - Intergenic
926018346 2:9474128-9474150 GCGCCCAGCGTCACTCTGGAGGG - Intronic
926371386 2:12182216-12182238 GACCCTATAATCACACTGGATGG + Intergenic
926904495 2:17793141-17793163 ACCCGCACAATCACCCTGCAAGG + Intronic
927953584 2:27191280-27191302 GCCCCCATTAACACCCTGGGAGG - Intergenic
930015150 2:46964939-46964961 GCCCCCAGCGTCAGCCTGGCCGG + Intronic
931174532 2:59840003-59840025 GCTCCCATAATCCCCCTGGGAGG + Intergenic
935671160 2:105558335-105558357 GCCCTCACAATCACGGTGGAAGG + Intergenic
939535246 2:143420032-143420054 GCTCCCAGAATCACACTACATGG + Intronic
940848039 2:158662014-158662036 GCCCCCAGGAGGATCCTGGATGG - Intronic
944850718 2:203716286-203716308 GCCTCCAGAATCATCCTGTCTGG + Intronic
946756525 2:222953098-222953120 GCCCCCAGAATAACCATAAATGG - Intergenic
1171159389 20:22907582-22907604 ACCCTCAGAATGACCCTGTATGG - Intergenic
1171235272 20:23519393-23519415 GCCTCCAAACCCACCCTGGAAGG + Intergenic
1172185263 20:33027511-33027533 GGCCCCAGAATCGCCCTGCCTGG - Intergenic
1172779202 20:37425812-37425834 GGCTCCAGAATCACCCTGTAAGG + Intergenic
1173324351 20:42019003-42019025 GCCCTCACAATCAGCCTGTAAGG + Intergenic
1175126070 20:56752350-56752372 GCCCCAAGAATCCCCATGGTGGG - Intergenic
1175778484 20:61667583-61667605 GCCCCCACACACACCCTGGGAGG + Intronic
1175912678 20:62412276-62412298 GTCCCCACCATCATCCTGGAAGG - Intronic
1176050054 20:63114316-63114338 TCCCCCAGAGACACACTGGAGGG + Intergenic
1177730541 21:25023197-25023219 ACCTGCAGAATGACCCTGGAAGG + Intergenic
1178172707 21:30059742-30059764 TTCCCCAGAATTACCCTAGAAGG + Intergenic
1178256168 21:31054336-31054358 GCCCACAGCATTTCCCTGGATGG - Intergenic
1179270997 21:39850902-39850924 GCCCCAGGACTGACCCTGGAAGG + Intergenic
1179480180 21:41671977-41671999 GCCCCCAGCAGCTCCCTGGGCGG - Intergenic
1181169095 22:20998302-20998324 GCCTCCAGGATTCCCCTGGAAGG - Exonic
1183371319 22:37434043-37434065 ACCCCCAGCATCTCCCTGGAGGG - Intergenic
1184159428 22:42689082-42689104 GCCGCCACACCCACCCTGGAAGG - Intergenic
1184391700 22:44206885-44206907 GGCCCCAGAGTCACCCTCCAGGG + Exonic
1184997905 22:48223755-48223777 GCTCCCAGGATAACCCTGGTGGG - Intergenic
1185173760 22:49307655-49307677 GCCCCCAGAAGCCCCAGGGAAGG + Intergenic
951796885 3:26549022-26549044 GCCACCATACTCAGCCTGGAAGG + Intergenic
952278974 3:31904640-31904662 GGCCCCAGAGTCACCCTAGGAGG - Intronic
952999659 3:38920933-38920955 GCCCACAGGAGCACCCTGGATGG + Intronic
953638571 3:44684703-44684725 GTCCTCAGTATCTCCCTGGAAGG + Intergenic
953848787 3:46449551-46449573 GCCCCCGGATTCATCCAGGAGGG + Intronic
954297850 3:49684175-49684197 GCCCCCGTAGTCACCCTGGCAGG + Exonic
954814501 3:53270125-53270147 GCCCTCTGACTCACCCTAGAAGG + Intergenic
954815713 3:53278834-53278856 TCTCCCAGAAACACCCTTGAAGG - Intergenic
954855846 3:53642774-53642796 GACCCCACAATCACCCAGGTGGG - Intronic
954982217 3:54756644-54756666 GACCACAGAATGACCCTGGGAGG + Intronic
963844354 3:150140512-150140534 AACACCAGAATCACACTGGATGG - Intergenic
966245522 3:177803911-177803933 GGCCCCACATTCACCCTGCAAGG - Intergenic
966917106 3:184591070-184591092 GACCCCAGAATGGCCCTGGGAGG + Intronic
967101628 3:186220786-186220808 GGGCCCAGAATTACCCTTGAAGG - Intronic
967962307 3:194935574-194935596 GCCCCCAGAATGAACAAGGACGG + Intergenic
968369424 3:198213579-198213601 GCCTCCATAAACACCCTGAAAGG - Intergenic
968972271 4:3802283-3802305 TCACCCAGCATCACCCTGCAGGG + Intergenic
971350878 4:25854970-25854992 GGCCTCAAAATCACCCTGCATGG + Intronic
972593635 4:40511191-40511213 GCCGCCAGAATCACCTTGAAAGG + Intronic
979257850 4:118623293-118623315 GCCTCCATAAACACCCTGAACGG - Intergenic
979330499 4:119417269-119417291 GCCTCCATAAACACCCTGAACGG + Intergenic
981226244 4:142297940-142297962 TTGCCCAGAACCACCCTGGAAGG + Intronic
982966238 4:161912542-161912564 GGCCTCAGAATCACGGTGGAAGG - Intronic
983552426 4:169031537-169031559 GCCACCACACGCACCCTGGAGGG + Intergenic
984208619 4:176817809-176817831 GCTGATAGAATCACCCTGGAAGG - Intergenic
985670537 5:1204412-1204434 GCCCCCAGCACCACCCTCGGGGG - Intronic
990362389 5:55033757-55033779 GCCCCCTGAGTCACCCTGGAAGG - Exonic
995455584 5:112348531-112348553 GTCCCCTGAATCACACTGCAGGG + Intronic
997437888 5:133888172-133888194 ACCCTGAGAATGACCCTGGATGG - Intergenic
998219143 5:140261882-140261904 GAGCCCTGCATCACCCTGGATGG - Intronic
999327258 5:150650935-150650957 GCCAGCAGAAGGACCCTGGAGGG - Exonic
1000372929 5:160554596-160554618 GCCCTGAGAATGACCCTGAAAGG + Intergenic
1000879317 5:166679149-166679171 AGCTCCAGATTCACCCTGGAAGG + Intergenic
1001181508 5:169525238-169525260 GGCCTCAGAATCACCGTGGGAGG + Intergenic
1001494671 5:172179390-172179412 GCCCCCAGAACAGCCCTGGGTGG - Intronic
1001536356 5:172500959-172500981 TCCTCGAGAAACACCCTGGAGGG - Intergenic
1002728703 5:181319164-181319186 GCCTCCATAAACACCCTGAAAGG - Intergenic
1002780642 6:362935-362957 GCCCCCAGAAGCTTCCTGGGAGG + Intergenic
1002785914 6:400045-400067 GCCCCGAGAATCACCTCGAATGG + Intronic
1008163690 6:48108655-48108677 TCTCCCAGAATCAACTTGGAGGG - Intergenic
1008542755 6:52559520-52559542 GCCCCCACAATCAGCCTGTGTGG - Intronic
1009518012 6:64643821-64643843 GGCCACACAATCATCCTGGAAGG - Intronic
1013276167 6:108586805-108586827 ATGCCCAGAATCACACTGGAGGG - Intronic
1018224308 6:161613193-161613215 GCCCTCAGAGTCATCCAGGAGGG - Intronic
1020004341 7:4774346-4774368 GCCCCGAGAAGACCCCTGGATGG - Intronic
1023274364 7:38502366-38502388 CCCCTGAGAATCACCCTGTATGG + Intronic
1023399839 7:39784579-39784601 GCCTCCATAAACACCCTGAATGG - Intergenic
1025184401 7:56846033-56846055 GCCTCCATAAACACCCTGAATGG + Intergenic
1025687526 7:63730935-63730957 GCCTCCATAAACACCCTGAATGG - Intergenic
1026278564 7:68901943-68901965 GGCCTCAGAATCACCGTGGGAGG - Intergenic
1027227265 7:76251671-76251693 GCCCCCAGCAGCACTTTGGAAGG + Intronic
1029126131 7:98296216-98296238 GCCCCCACGATCACCCAGCATGG - Intronic
1029260184 7:99296909-99296931 GCCCTCAGACTCACCCTGCAGGG - Intergenic
1029627953 7:101732109-101732131 GCCCCCCTCATCACCCTGGTGGG - Intergenic
1031109760 7:117594049-117594071 GTCCCCACAACTACCCTGGAAGG + Intronic
1033582914 7:142752860-142752882 GCCACCAGAATCACCCTGGGGGG - Exonic
1033585940 7:142774348-142774370 GCCACCAGAATCACCCTGGGGGG - Intergenic
1034715394 7:153236875-153236897 GCTGCCAGAAACACCCTGAAGGG - Intergenic
1035532542 8:364685-364707 GCCCACAGAATCAGACTTGAAGG + Intergenic
1036246203 8:7119182-7119204 GACCCCAGGAACATCCTGGAAGG + Intergenic
1038672290 8:29592019-29592041 GCCCACAGCCACACCCTGGATGG - Intergenic
1039922804 8:41905162-41905184 GCCTGCAGACTCACCCTGGTGGG - Intergenic
1042796904 8:72674026-72674048 GTCCCCACAATGACCATGGAAGG - Intronic
1045642003 8:104261407-104261429 GACCTCAGAATCCTCCTGGATGG + Intergenic
1047781082 8:128111686-128111708 GTCCCCAAAGTCACCATGGAAGG + Intergenic
1048519349 8:135139386-135139408 CTCACCAGAATCACCCTGTATGG + Intergenic
1049234732 8:141506926-141506948 GCCCCCAGGAGCAGCCTGCAGGG - Intergenic
1049358698 8:142201614-142201636 CCCCCCAGCCTCCCCCTGGAAGG + Intergenic
1050910100 9:11056852-11056874 GCCCCCAGAATCATAGTGGGAGG - Intergenic
1056215827 9:84405088-84405110 ACCCCCAGAATACCCCTGCAAGG + Intergenic
1058781204 9:108337403-108337425 GCACCCAGAATAATCATGGAAGG - Intergenic
1058814496 9:108670842-108670864 GCCTCCAGAAACACCCAGGTTGG + Intergenic
1060890948 9:127187960-127187982 GCCCACAGAATCAACCTCCAGGG + Intronic
1061169112 9:128941741-128941763 GCCCACAGCTTCACCCGGGAGGG - Exonic
1061498110 9:130987143-130987165 GTGCCCAGAGTCACCCAGGAGGG + Intergenic
1062027590 9:134347640-134347662 ACCCGCAGCATCCCCCTGGAGGG - Intronic
1062047500 9:134431300-134431322 GCCCCCAGCGTCTCCATGGAGGG + Intronic
1062543483 9:137051789-137051811 GCCCCCAGAAACGCCCAGGTTGG + Intronic
1062617115 9:137402833-137402855 GGCCTCAGAATCACGGTGGAAGG + Intronic
1062753763 9:138276263-138276285 GCCTCCATAAACACCCTGAAAGG - Intergenic
1203576279 Un_KI270745v1:11042-11064 GCCTCCATAAACACCCTGAAAGG - Intergenic
1185461621 X:335298-335320 GCCCCCAGACCTAGCCTGGATGG - Intronic
1186303987 X:8234057-8234079 CCCCCCAAAATCACCCATGAGGG + Intergenic
1186433453 X:9523645-9523667 GCCCCCAGCCCCACCCTTGACGG + Intronic
1189403362 X:40693485-40693507 GGCCTCAGAATCACAGTGGAAGG - Intronic
1189897742 X:45673267-45673289 CCCCCCAGAAGCATCCTGGTTGG - Intergenic
1193783816 X:85734954-85734976 GGCCAAAGAATCACCCTGCATGG - Intergenic
1193995766 X:88364803-88364825 TTCCCCAGAAGCAGCCTGGATGG + Intergenic
1195536352 X:106013093-106013115 GCCCACGAAATCATCCTGGAGGG + Intergenic
1196693912 X:118590765-118590787 GCCACCAGAATCCCACTGGCTGG + Intronic