ID: 1167700049

View in Genome Browser
Species Human (GRCh38)
Location 19:51037877-51037899
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 4, 1: 8, 2: 15, 3: 28, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167700046_1167700049 2 Left 1167700046 19:51037852-51037874 CCGGGCGTGGTGACTCACGTCTG 0: 8
1: 564
2: 11980
3: 67479
4: 139263
Right 1167700049 19:51037877-51037899 ATCCCAGCACTAGGCCGAGGTGG 0: 4
1: 8
2: 15
3: 28
4: 204
1167700045_1167700049 13 Left 1167700045 19:51037841-51037863 CCAAGGTGGGGCCGGGCGTGGTG No data
Right 1167700049 19:51037877-51037899 ATCCCAGCACTAGGCCGAGGTGG 0: 4
1: 8
2: 15
3: 28
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167700049 Original CRISPR ATCCCAGCACTAGGCCGAGG TGG Intergenic
901948421 1:12722077-12722099 ATCCCAGCACGAGGCCAAGGTGG + Intronic
904715049 1:32461394-32461416 ATCCCAGCACTAGGAGAACGAGG - Intergenic
904749744 1:32734179-32734201 ATCCCAGCACTGGGCCCAAAGGG - Intergenic
904804080 1:33118793-33118815 ATCCCAGCACTAGCCTGGTGGGG - Intronic
904820950 1:33243862-33243884 ATCCCAGCACTTTGCAAAGGAGG - Intergenic
906136674 1:43505053-43505075 ATCTCAGCACTAGGCTGAGGCGG - Intergenic
907499716 1:54869797-54869819 ATCCCAGCACTTGGCTTGGGAGG + Intronic
908696956 1:66854549-66854571 ATCCCAGCACTGGGAGGCGGAGG + Intronic
912010638 1:104957396-104957418 ATCCCAGCACTTTGCCGAGGCGG + Intergenic
912996917 1:114539730-114539752 ATCCCAGCACTTTGGCGTGGTGG + Intergenic
918553990 1:185777695-185777717 ATCCCAGCAGGAAGCTGAGGCGG - Intronic
919009372 1:191939923-191939945 ATCCCAGCACTTGGGAGAAGGGG + Intergenic
919996260 1:202753914-202753936 ATCTCAGCACTAAGCTGAGGCGG - Intronic
922293175 1:224225898-224225920 ATCCCAGCACTAGGCCAAGGCGG - Intergenic
923541358 1:234890521-234890543 ATCCCAGCACATGACTGAGGTGG - Intergenic
924064578 1:240208407-240208429 ATCCCAGCACCAGGTAGAGGGGG - Exonic
1064634122 10:17346352-17346374 ATCCCAACACTTTGCTGAGGTGG + Intronic
1065796821 10:29315598-29315620 ATCCTAACACTTTGCCGAGGTGG + Intronic
1067456252 10:46421268-46421290 GTCCCTGCACAGGGCCGAGGAGG + Intergenic
1067630947 10:47963371-47963393 GTCCCTGCACAGGGCCGAGGAGG - Intergenic
1068338520 10:55669130-55669152 AATTCAGCACTAGGCTGAGGGGG - Intergenic
1070711895 10:78689065-78689087 AGCCCAGCACCAGGCAGAGGTGG - Intergenic
1070771790 10:79086624-79086646 GTCCCAGCAGGAGGCAGAGGTGG - Intronic
1072211895 10:93253885-93253907 ATCTCAGCACTAGGCCGAGGTGG - Intergenic
1072583148 10:96757720-96757742 ATCCCAGCGGGAGGCTGAGGCGG + Intergenic
1072680010 10:97499323-97499345 AGCCCAGGACTCGGGCGAGGAGG - Intronic
1076094421 10:127719740-127719762 ATCCCAGCACTTTGGCGAGGCGG - Intergenic
1078132348 11:8623241-8623263 ATCCCAGCACTTGGCTGACATGG - Intronic
1078329669 11:10409168-10409190 AGCCCTGCACTAGGTCCAGGAGG - Intronic
1078504634 11:11925353-11925375 ATCCCAGTGGGAGGCCGAGGTGG - Intronic
1079250225 11:18781565-18781587 ATCCCAGCACCAGGCCGAGGCGG - Intronic
1080266615 11:30408117-30408139 AAATCAGCACTAGTCCGAGGTGG + Intronic
1083261879 11:61527595-61527617 ATCACAGCCAGAGGCCGAGGAGG - Intronic
1083582632 11:63834867-63834889 ATTTCAGTACTACGCCGAGGTGG - Intergenic
1083640269 11:64141655-64141677 ACCCGAGCACTGAGCCGAGGAGG - Intronic
1083760743 11:64815821-64815843 ATCCCAGCACTTAACTGAGGCGG + Intergenic
1083999544 11:66288772-66288794 TTCCCAGGACTGGGCCGAGAGGG + Intronic
1084594338 11:70108035-70108057 ACACCAGCACTAGGCCCAGGAGG + Intronic
1087571624 11:99934635-99934657 ATCCCAGCACAAGGCCATGGTGG + Intronic
1087902932 11:103663069-103663091 ATCTCTGCAGTTGGCCGAGGGGG - Intergenic
1088182711 11:107130040-107130062 AACCCAGCACTAGGCCAAGCTGG - Intergenic
1091208570 11:133836989-133837011 ATCCAAGCACTAAGCCAAGCAGG - Intergenic
1091721027 12:2813763-2813785 ATCACAGCACTAGGGGGCGGTGG - Intronic
1091791614 12:3275189-3275211 ATCCCAGCACTTATCCCAGGAGG + Intronic
1092221223 12:6715329-6715351 ATCCCAGCACTGGGAGGACGAGG - Intergenic
1092831119 12:12445291-12445313 ATCCCAGCACTTTGGGGAGGTGG - Intronic
1093104909 12:15074788-15074810 ATCCCAGCACTTTGCGGGGGAGG + Intergenic
1094611236 12:31997590-31997612 ATCCCAGCACTAGGAGGCCGAGG - Intergenic
1098424445 12:70344473-70344495 ATCCCAGCACTTTGGTGAGGTGG + Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1101387824 12:104273339-104273361 ATCCCAGCACTAATGGGAGGCGG + Intronic
1102964052 12:117112656-117112678 ATCCCAGCGCTTTGCCAAGGTGG - Intergenic
1103772386 12:123338298-123338320 ATCCCAGCACTTGGGCAAGCAGG + Intronic
1104450033 12:128861503-128861525 TTCCCTGCTCTGGGCCGAGGAGG - Intronic
1105330390 13:19410531-19410553 AACCCAACACCAGGCCGTGGGGG - Intergenic
1105874454 13:24540432-24540454 GTCCCAGCACTGGGCCAAGCAGG + Intergenic
1106489675 13:30208327-30208349 ATACCAGCACAAAGCCGGGGAGG + Exonic
1106953085 13:34906356-34906378 CTCCCAACACTGGGCAGAGGAGG - Intergenic
1108034166 13:46270719-46270741 TTCACAGCCATAGGCCGAGGAGG + Intronic
1109760586 13:66822758-66822780 ATCCCAGCACTGGGAGGTGGAGG - Intronic
1111858211 13:93667678-93667700 ATCCCAGCACAAGGCCAAGGTGG - Intronic
1113021924 13:105896658-105896680 ATCTCTGCACTTGGCAGAGGAGG - Intergenic
1116233919 14:42253624-42253646 ATCCCAGAACAAGGAGGAGGAGG + Intergenic
1117367980 14:55050480-55050502 ATCCCAGCACTTTGCCGAGGAGG + Intergenic
1118443686 14:65833501-65833523 ATCCTAACACTAGCCCCAGGAGG - Intergenic
1120585320 14:86305453-86305475 ATCCCAGCACTTTGGGGAGGCGG - Intergenic
1120766492 14:88331838-88331860 ATACAGGCACTAGGCTGAGGTGG - Intergenic
1121338506 14:93091561-93091583 AGCCCAGCACTCGGCGTAGGAGG - Intronic
1121820769 14:96964312-96964334 CTCCCAGCACACAGCCGAGGGGG - Intergenic
1121846034 14:97173230-97173252 ATCCCACCCCCAGGCCCAGGAGG + Intergenic
1123686206 15:22799395-22799417 ATCCCAGTAATCTGCCGAGGTGG + Intronic
1123913891 15:25000893-25000915 ATCCCAGCACGAGGCCGAGGTGG + Intergenic
1125306670 15:38325083-38325105 ATCCCAGCACTGTGGGGAGGTGG - Intronic
1126594040 15:50368325-50368347 ATCCCAGCACTAGGAGGCCGAGG + Intergenic
1126823329 15:52526606-52526628 ATCCCAACACGTTGCCGAGGTGG - Intronic
1127619348 15:60718044-60718066 ATCCCAGTGCGAGGCCAAGGTGG - Intronic
1127806868 15:62529339-62529361 ATACCAACACAAGGCCAAGGTGG - Intronic
1128037264 15:64537842-64537864 ATCCCAGCACTTTGCAAAGGAGG + Intronic
1129488309 15:75899005-75899027 ATCCCAGCACTTTGGGGAGGTGG + Intronic
1129518295 15:76170383-76170405 ATCCCAGCACTGAGCCAAAGAGG - Intronic
1129524244 15:76204009-76204031 ATCCCAGCAGCAGGTGGAGGAGG + Exonic
1132768179 16:1545633-1545655 ATCCCAGGGCTCGGCAGAGGTGG + Intronic
1133607110 16:7398747-7398769 ATCCCAGCTCTAGCCCCATGTGG + Intronic
1133677306 16:8086635-8086657 ATCCCAGCACAAGGCCTCGTGGG + Intergenic
1133962695 16:10508407-10508429 ATCCCAGCACTCAGGGGAGGCGG - Intergenic
1135170062 16:20176093-20176115 ATCCCAGCACTTTGGTGAGGCGG - Intergenic
1135182395 16:20287206-20287228 ATCCCAGCACTTTGCTGAGGCGG + Intergenic
1135244377 16:20842585-20842607 GTCCCAGCAGGAGGCTGAGGTGG - Intronic
1136370735 16:29834419-29834441 ATCCCAGCACTTTGCCAAGGTGG + Intronic
1137397675 16:48127805-48127827 ATCTCAGCACTTGACCCAGGAGG + Intronic
1138106239 16:54288338-54288360 TCCCCAGCACCAGGCAGAGGCGG - Intergenic
1138497382 16:57416575-57416597 ACCCCAGCTCCAGGGCGAGGGGG + Intergenic
1139742413 16:69046570-69046592 ATCCCAGCACTTTGGCAAGGAGG - Intronic
1140084320 16:71780239-71780261 ATCCCAGCACGAGGCCAAAACGG - Intronic
1140131654 16:72167150-72167172 ACCCCTGCACAAGGCCGAGGGGG + Intronic
1141153233 16:81579160-81579182 ATCCCTGCAATAGCCCTAGGAGG - Intronic
1141935100 16:87233215-87233237 TTGCCAGCACTATGCCAAGGAGG + Intronic
1141950407 16:87335782-87335804 ATCCCCGCACTGGGCTGAGCGGG + Intronic
1142376629 16:89710041-89710063 CTCCCTGCCCTGGGCCGAGGAGG - Intronic
1142864029 17:2779629-2779651 AGGCCAGCACTGGGCAGAGGAGG + Intronic
1144809340 17:17988758-17988780 ATCCCAGCTGTGGGCCGTGGTGG + Intronic
1146203246 17:30879294-30879316 ACCACAGCACTAGGCAGTGGTGG + Intronic
1146258198 17:31403984-31404006 ATCCCAGCACTGGGCAGGGAGGG + Intronic
1146259162 17:31410594-31410616 GTCCCAGCACTGCACCGAGGGGG + Intronic
1146794127 17:35769573-35769595 AGCCCACCACCAGGCAGAGGTGG + Intronic
1147238455 17:39074766-39074788 AGCCCAGCACTGGGCCAGGGCGG - Intronic
1147413504 17:40271389-40271411 ATCCCAGCCCTTTGCTGAGGCGG + Intronic
1147633677 17:41949273-41949295 GTCCCAGCAGTGTGCCGAGGAGG + Exonic
1147756025 17:42768554-42768576 ATCCCAGCACTAGGAGGCTGAGG + Intergenic
1148172835 17:45537687-45537709 ATTCCAGCACTTTGCTGAGGTGG - Intergenic
1148276433 17:46307763-46307785 ATTCCAGCACTTTGCTGAGGTGG + Intronic
1148282245 17:46357585-46357607 GTCCCAGCAGAAGGCTGAGGTGG - Intronic
1148298549 17:46525338-46525360 ATTCCAGCACTTTGCTGAGGTGG + Intronic
1148304463 17:46575510-46575532 GTCCCAGCAGAAGGCTGAGGTGG - Intronic
1148499619 17:48079740-48079762 ATCCCAGTAGGAGGCTGAGGTGG - Intronic
1148624605 17:49059430-49059452 ATCCCAGCGGGAGGCTGAGGTGG + Intergenic
1150404041 17:64884610-64884632 ATTCCAGCACTTTGCTGAGGTGG - Intronic
1150571947 17:66394293-66394315 CACCCAGCACTAGCCCAAGGTGG + Intronic
1151543421 17:74776846-74776868 CTCCCTGCCCTAGGCAGAGGCGG + Intronic
1151640277 17:75387337-75387359 GTCCCAGCTATAGGCTGAGGTGG + Intronic
1151673383 17:75585305-75585327 ATCCCAGCTACAGGCTGAGGTGG + Intergenic
1152389509 17:79994269-79994291 ATCCCAGCTCAGGGCCGGGGGGG + Intronic
1153171110 18:2317033-2317055 ATCCCAGGAGTTGGGCGAGGGGG + Intergenic
1153715522 18:7843927-7843949 ATCCCAGCAGCAGCCCCAGGTGG - Intronic
1157240893 18:46008557-46008579 ATCCCAGCACTTTGCCGAGGTGG - Intronic
1157247403 18:46066775-46066797 ATCCCAGCACTTTGCCCAGGCGG + Intronic
1158607819 18:58911474-58911496 ATCCCAGCACTTGGGAGGGGAGG + Intronic
1160886814 19:1353992-1354014 ATCCCAGCAGGAGGCCGAGGCGG - Intergenic
1160933516 19:1582152-1582174 ATCCCAGCACTTGGCGGGGCTGG - Intronic
1163509728 19:17727445-17727467 CTCCCCGCACTCGACCGAGGTGG + Exonic
1164591331 19:29509084-29509106 ATCTCAGCAATAGGCCGCAGAGG + Intergenic
1164999612 19:32750348-32750370 ACCTCAGCACCAGGCAGAGGTGG + Intronic
1165396688 19:35568262-35568284 ATCCCAGCACTAGGAGGCTGAGG + Intergenic
1165594580 19:37001553-37001575 ATCCCAGCATGAGGCTAAGGCGG - Intergenic
1165619391 19:37232318-37232340 ATCCCAGCACTTTGCGAAGGTGG - Intronic
1166958617 19:46484034-46484056 ATCCCAGCACTTTGCAAAGGAGG + Intronic
1167700049 19:51037877-51037899 ATCCCAGCACTAGGCCGAGGTGG + Intergenic
927827882 2:26322026-26322048 ATCCCAGCACTACACCTTGGAGG + Intronic
928968918 2:37006392-37006414 ATCTCAGCACCCAGCCGAGGTGG + Intronic
930191416 2:48463806-48463828 ATGCAAGCAGTAGACCGAGGTGG + Intronic
932359861 2:71095434-71095456 ATCCCAGCACTAGGCCGAGGTGG + Intergenic
932506910 2:72242976-72242998 ATCCCAACACTAGGAAAAGGAGG - Intronic
932685664 2:73867295-73867317 ATCCCAGCAGGAGGCCAAGGCGG + Intronic
933176502 2:79179594-79179616 ATCTCAGCACTGGGCAGAGGTGG - Intergenic
938336775 2:130508123-130508145 ATCCCAGCACTTTGGGGAGGCGG - Intronic
938343799 2:130552365-130552387 ATCTCAGCAGGAGGCCCAGGTGG - Intergenic
938346034 2:130568357-130568379 ATCTCAGCAGGAGGCCCAGGTGG + Intergenic
941930517 2:170934511-170934533 ATCCCAGCACTTGTCGGAGGTGG - Intronic
947738093 2:232468904-232468926 ATCCCAGCATGAGGTTGAGGTGG - Intergenic
948471061 2:238179630-238179652 ATCCCAGCACTTGGCTCCGGTGG - Intronic
948529205 2:238593320-238593342 ATCCCAGCACTGGGAGGATGAGG - Intergenic
1169165956 20:3424187-3424209 ATCCCAGCACTTTGTGGAGGCGG + Intergenic
1169216328 20:3796615-3796637 ATCCCAGCAGGAGGCCCGGGAGG - Exonic
1174019983 20:47522347-47522369 CTCCCAGCACTTTGCCGACGCGG - Intronic
1174049703 20:47759079-47759101 ATCACAGCACTGGGCAGGGGAGG + Intronic
1174643104 20:52062292-52062314 ATTCCAGCACTTTGCTGAGGTGG - Intronic
1175082066 20:56429068-56429090 ATCCCCTCTCTAGGCCGGGGTGG - Intronic
1177825134 21:26074501-26074523 ATTCCAGCACTAGGCCGAGGCGG + Intronic
1178847041 21:36182579-36182601 ATCCCAGCACTTGGCTGAGGCGG + Intronic
1180960209 22:19759086-19759108 CACCCAGCCCTAGCCCGAGGTGG - Intronic
1181230121 22:21417215-21417237 GTCCCAGCACTAGGCGGGGCGGG - Intergenic
1181248528 22:21517651-21517673 GTCCCAGCACTAGGCGGGGCGGG + Intergenic
1183952200 22:41358179-41358201 GTCCCAGCACAAGGCAGAGCTGG + Exonic
1184051544 22:42009161-42009183 ATCCCAGCACAAGGCCAAGGTGG - Intronic
1184457950 22:44622066-44622088 ATCCCAGGGCTGGGCCGTGGTGG + Intergenic
1184960071 22:47922199-47922221 CTCCCAGCACCTGGCTGAGGAGG + Intergenic
1185293129 22:50037450-50037472 ATCCCAGCACTAGGCCGAGGCGG - Intronic
950020952 3:9787295-9787317 CTCCCAGCGCTGGGCCCAGGAGG - Exonic
950344722 3:12282634-12282656 ATCCCAGCACTAGGCCAAGGTGG - Intergenic
954255960 3:49406519-49406541 ATCCCAGCAGGAAGCTGAGGCGG + Intronic
956181319 3:66520431-66520453 GTCCCAGCACAAGGACCAGGAGG - Intergenic
956815596 3:72905363-72905385 ATCCCAGCAGGAGTTCGAGGCGG - Intronic
959167040 3:102793603-102793625 ATCCCAGCACTTTGGGGAGGTGG - Intergenic
959408127 3:105986776-105986798 ATCCCAGCACTAGGCCGAGGTGG + Intergenic
959468540 3:106720674-106720696 CTCCCACCACTGGGCCGAGTGGG - Intergenic
960139713 3:114140271-114140293 ATCCCAGCACTTGTCAGAGGTGG + Intronic
960519429 3:118638043-118638065 ATTCCAGCAAAAGGCGGAGGGGG - Intergenic
961435377 3:126912907-126912929 TTCCCTGCAGAAGGCCGAGGGGG + Intronic
963833762 3:150035645-150035667 GTCCCAGCGCTAGGTGGAGGAGG - Intronic
964104809 3:153027633-153027655 CTCCCAGCAGTAAGCCCAGGAGG - Intergenic
968108039 3:196016709-196016731 ATCCTAGCACTAGACTGAGAAGG + Intergenic
968877845 4:3283549-3283571 ATCCCAGCAGAAGGCACAGGTGG + Intergenic
974646251 4:64697122-64697144 ATCCCAGCACTCTGTCGAGGCGG + Intergenic
977032847 4:91908655-91908677 ATCCCAGCACTAGGTCGAGGAGG + Intergenic
978441836 4:108741460-108741482 ATCCCAGCACTAGGAGGCTGAGG + Intergenic
979056792 4:116005588-116005610 TTCCCACCCCTAGGCAGAGGAGG + Intergenic
984160992 4:176251812-176251834 ATCCCAGCATTAGGCGGAGGCGG + Intronic
984371486 4:178872167-178872189 ATCCCAGCACTTCACTGAGGAGG + Intergenic
985590861 5:764404-764426 AACCCAGCACTAGTTCGGGGTGG + Intronic
986253410 5:6081861-6081883 GTCCCAGCTCTATGCCCAGGAGG + Intergenic
986812040 5:11370366-11370388 ATCCCAGCATTAGAACCAGGAGG - Intronic
987114612 5:14716247-14716269 ATCCCAGCACTTTGCCGAGGAGG + Intronic
988021681 5:25629119-25629141 GTCCCAGCACTGGGGCGAGGTGG + Intergenic
995057160 5:107772751-107772773 ATCACAGCAACAGGACGAGGAGG - Intergenic
996516902 5:124380573-124380595 ATGCCAGCACTAGGCAGTGGTGG - Intergenic
998344542 5:141450263-141450285 ATCCCAGCACTTAGCTGAGGTGG - Intronic
998355533 5:141532415-141532437 ATCCCAGCAGGAAGCTGAGGTGG - Intronic
999044099 5:148448954-148448976 ATCCCAGCCCTAGTCCAAAGTGG + Intergenic
999248472 5:150167688-150167710 AACCCAGCCCTAGGCAAAGGCGG + Intronic
1000025422 5:157354814-157354836 TTCCCAGATCTAGGCAGAGGCGG - Intronic
1001454774 5:171852291-171852313 ATCCCATCAGGAGGCCCAGGGGG + Intergenic
1003918303 6:10807809-10807831 ATCCCAGCACTATGCATAGGAGG + Intronic
1004939989 6:20545681-20545703 ATCCCAGCACTTTGGGGAGGTGG - Intronic
1005899720 6:30206912-30206934 AGGCCAGCACTAGCACGAGGTGG + Intronic
1006328114 6:33369447-33369469 ATCCCACCACTTTGCCGAGGCGG + Intergenic
1006328299 6:33370959-33370981 GTCCCAGCTATAGGCTGAGGTGG + Intergenic
1006500682 6:34457100-34457122 AGCCAAGCATTAGGCCAAGGAGG - Intergenic
1006899613 6:37491396-37491418 AGCCCAGCACCAGGCCCCGGGGG - Intronic
1007177387 6:39906311-39906333 ATCCCAGCTCCAGGCCTGGGTGG + Exonic
1007276224 6:40676098-40676120 AGCCCAGCACCTGGCCCAGGTGG - Intergenic
1007504942 6:42328440-42328462 ATCCAGGCACTAAGCCTAGGAGG + Intronic
1011087637 6:83560195-83560217 GTCCCAGCAGGAGGCTGAGGAGG + Exonic
1013283468 6:108660612-108660634 ATCCCAGCACTTGGGTGGGGAGG + Intronic
1013323627 6:109021687-109021709 ATCCCAGTAGGAGGCCAAGGCGG - Intronic
1015477836 6:133673149-133673171 AAGTCAGCACTAGGCTGAGGAGG - Intergenic
1015526039 6:134175862-134175884 ATCCCAGAACTTGGAAGAGGAGG + Intronic
1016606436 6:145934217-145934239 ATCCCAGCACGAGGCTGAGAGGG + Intronic
1020120135 7:5498505-5498527 ATCCCAGCACTTTGCCAGGGAGG - Intronic
1020239508 7:6382240-6382262 ATCCCAGCAAGAGGCCAAGGCGG - Intronic
1025071576 7:55904212-55904234 ATCCCAGCACCAGGCCGAGGCGG + Intronic
1025074466 7:55931033-55931055 ATCCCAGCACTTGGGAGACGAGG + Intronic
1026649903 7:72207566-72207588 ATCCCAGCACTACCAGGAGGCGG - Intronic
1026866151 7:73825212-73825234 CACCCAGCACCAGGCCGAGGGGG + Intronic
1030111845 7:106033489-106033511 ATGCCAGCACTTTGCCAAGGTGG + Exonic
1030292949 7:107890357-107890379 AGCCCAGCACAAGGCCTGGGTGG + Intergenic
1031346528 7:120673759-120673781 ATGCCATCACTAGGCCATGGAGG - Intronic
1035221538 7:157409348-157409370 ATTCCAGCACGAGGCGGAGAGGG + Intronic
1035291335 7:157841081-157841103 CTCCCAGCACAGGGCAGAGGCGG + Intronic
1037163595 8:15800314-15800336 ATCCCAGCACTAAGGCTGGGAGG + Intergenic
1037683731 8:21119875-21119897 ATCCCAGCTGGAGGCTGAGGAGG + Intergenic
1038021815 8:23557488-23557510 ATCACAGCAGGAGGCCCAGGAGG - Intronic
1039878380 8:41607136-41607158 ATCCCAGCACTATGGGCAGGAGG - Intronic
1039929772 8:41974324-41974346 ATCCTAGCACTTTGCCAAGGTGG - Intronic
1040476577 8:47783334-47783356 ATCCCAGCACTTTGCGGAGGCGG + Intronic
1040946820 8:52893289-52893311 AACCCAGCACTGGGCTGGGGAGG - Intergenic
1049366434 8:142239044-142239066 ATCCCACCCCTAGGCCCAGCTGG - Intronic
1049541926 8:143212556-143212578 TTCCCAGCAAGAGACCGAGGGGG + Intergenic
1053024710 9:34720073-34720095 ATCTCATCACTAGGAGGAGGAGG - Intergenic
1055329200 9:75164287-75164309 GACCCAACACTAGGCCGTGGGGG - Intergenic
1055481442 9:76712461-76712483 ATCCTAGCAATAGCCAGAGGTGG - Intronic
1055561140 9:77522828-77522850 AACCCAGCAGTAGGAAGAGGAGG + Intronic
1059181690 9:112220311-112220333 ATCCCAGCACTGTGGGGAGGTGG + Exonic
1060053172 9:120391452-120391474 TTCCCAGCACTCTGCTGAGGTGG - Intronic
1061156030 9:128862251-128862273 ATCCCAGCACTGGGACGCTGCGG - Intronic
1061671102 9:132188600-132188622 CGCCCAGCACAGGGCCGAGGTGG + Intronic
1061862375 9:133474690-133474712 ATCCCAACACGAGGCCAAGGCGG - Intronic
1062547880 9:137071785-137071807 AACCCAGCACGAGGCCGAGGCGG + Intergenic
1185789674 X:2919332-2919354 ATCCCACCACCAGGTCGGGGCGG + Intronic
1186203526 X:7177761-7177783 ATCCCAGCACTTTGCCGAGGTGG - Intergenic
1187952387 X:24483959-24483981 ATCCCAGTGGTAGGCCGGGGCGG - Intronic
1188137281 X:26505122-26505144 ATCCCAGCACCAGGTAGAGGGGG - Intergenic
1189271495 X:39755261-39755283 TCCCCTGCACCAGGCCGAGGAGG - Intergenic
1189988122 X:46571736-46571758 ATCCCAGCACAAGGCCGAAGTGG + Intergenic
1190295234 X:49022691-49022713 ATCCCAACAAAAGGCTGAGGTGG - Intergenic
1194639256 X:96383012-96383034 ATCCCAGCACTTTGCTGAGGTGG - Intergenic
1195509315 X:105696301-105696323 AGCCCAGGACTAGGGTGAGGGGG + Intronic
1195649582 X:107271197-107271219 ATCCCAGCACTTGGCCAAGGCGG - Intergenic
1195898150 X:109769635-109769657 ATCCCAGCACTATGGCAGGGAGG + Intergenic
1201651115 Y:16288178-16288200 ATCCCAGCAGGAGGCTTAGGAGG + Intergenic