ID: 1167701029

View in Genome Browser
Species Human (GRCh38)
Location 19:51045972-51045994
Sequence TCCAGGCTATTGAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167701029_1167701042 16 Left 1167701029 19:51045972-51045994 CCCACTGCCCTCAATAGCCTGGA No data
Right 1167701042 19:51046011-51046033 CAGCTACAAAGCCTCACCCTGGG No data
1167701029_1167701043 17 Left 1167701029 19:51045972-51045994 CCCACTGCCCTCAATAGCCTGGA No data
Right 1167701043 19:51046012-51046034 AGCTACAAAGCCTCACCCTGGGG No data
1167701029_1167701041 15 Left 1167701029 19:51045972-51045994 CCCACTGCCCTCAATAGCCTGGA No data
Right 1167701041 19:51046010-51046032 CCAGCTACAAAGCCTCACCCTGG No data
1167701029_1167701035 -10 Left 1167701029 19:51045972-51045994 CCCACTGCCCTCAATAGCCTGGA No data
Right 1167701035 19:51045985-51046007 ATAGCCTGGAAAGTTCCACGGGG No data
1167701029_1167701036 -9 Left 1167701029 19:51045972-51045994 CCCACTGCCCTCAATAGCCTGGA No data
Right 1167701036 19:51045986-51046008 TAGCCTGGAAAGTTCCACGGGGG No data
1167701029_1167701044 23 Left 1167701029 19:51045972-51045994 CCCACTGCCCTCAATAGCCTGGA No data
Right 1167701044 19:51046018-51046040 AAAGCCTCACCCTGGGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167701029 Original CRISPR TCCAGGCTATTGAGGGCAGT GGG (reversed) Intergenic
No off target data available for this crispr