ID: 1167702110

View in Genome Browser
Species Human (GRCh38)
Location 19:51054962-51054984
Sequence AAGAAGAAGGAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167702110_1167702117 17 Left 1167702110 19:51054962-51054984 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702110_1167702116 3 Left 1167702110 19:51054962-51054984 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1167702116 19:51054988-51055010 AGGGTCTTGCTCTGTCACCCAGG 0: 4209
1: 20933
2: 63781
3: 122612
4: 173503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167702110 Original CRISPR AAGAAGAAGGAGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr