ID: 1167702117

View in Genome Browser
Species Human (GRCh38)
Location 19:51055002-51055024
Sequence TCACCCAGGCTTGAGTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167702106_1167702117 24 Left 1167702106 19:51054955-51054977 CCCCTTCCCCTTCTCCTTCTCCT 0: 34
1: 141
2: 573
3: 1979
4: 7487
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702107_1167702117 23 Left 1167702107 19:51054956-51054978 CCCTTCCCCTTCTCCTTCTCCTT No data
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702110_1167702117 17 Left 1167702110 19:51054962-51054984 CCCTTCTCCTTCTCCTTCTTCTT No data
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702111_1167702117 16 Left 1167702111 19:51054963-51054985 CCTTCTCCTTCTCCTTCTTCTTC 0: 210
1: 1039
2: 2175
3: 5121
4: 13989
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702104_1167702117 29 Left 1167702104 19:51054950-51054972 CCCTTCCCCTTCCCCTTCTCCTT 0: 52
1: 297
2: 614
3: 1525
4: 5511
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702113_1167702117 10 Left 1167702113 19:51054969-51054991 CCTTCTCCTTCTTCTTCACAGGG No data
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702109_1167702117 18 Left 1167702109 19:51054961-51054983 CCCCTTCTCCTTCTCCTTCTTCT 0: 31
1: 125
2: 784
3: 2180
4: 6947
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702105_1167702117 28 Left 1167702105 19:51054951-51054973 CCTTCCCCTTCCCCTTCTCCTTC 0: 63
1: 327
2: 1289
3: 2733
4: 9402
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702115_1167702117 4 Left 1167702115 19:51054975-51054997 CCTTCTTCTTCACAGGGTCTTGC No data
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702103_1167702117 30 Left 1167702103 19:51054949-51054971 CCCCTTCCCCTTCCCCTTCTCCT 0: 49
1: 285
2: 676
3: 1883
4: 7241
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data
1167702108_1167702117 22 Left 1167702108 19:51054957-51054979 CCTTCCCCTTCTCCTTCTCCTTC 0: 38
1: 662
2: 1162
3: 3481
4: 13239
Right 1167702117 19:51055002-51055024 TCACCCAGGCTTGAGTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167702117 Original CRISPR TCACCCAGGCTTGAGTGTAC TGG Intergenic
No off target data available for this crispr