ID: 1167702474

View in Genome Browser
Species Human (GRCh38)
Location 19:51058182-51058204
Sequence CTTTAGGCACAGATGGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 9, 2: 45, 3: 153, 4: 395}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167702474_1167702476 -10 Left 1167702474 19:51058182-51058204 CCTGGATCCATCTGTGCCTAAAG 0: 1
1: 9
2: 45
3: 153
4: 395
Right 1167702476 19:51058195-51058217 GTGCCTAAAGCCAGACAACCTGG 0: 1
1: 0
2: 2
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167702474 Original CRISPR CTTTAGGCACAGATGGATCC AGG (reversed) Intronic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
900857738 1:5199528-5199550 CTTCAGGCACAGTGGTATCCAGG - Intergenic
901474111 1:9477304-9477326 CTTCAGGCAGAGGTGGATCCAGG - Intergenic
901508683 1:9702988-9703010 CTTCAGGCATGGCTGGATCCAGG + Intronic
901715256 1:11148550-11148572 CTTTAGGCATAGCTGGATGCAGG + Intronic
901783847 1:11611757-11611779 CTTCAGACACAGCTGAATCCAGG + Intergenic
901840113 1:11949013-11949035 CTTCAGGCATGGCTGGATCCAGG + Intronic
901866260 1:12109025-12109047 CTTCAGGCATGGCTGGATCCAGG + Intronic
902148577 1:14423996-14424018 CTTAAGGCACATATGTATCCAGG - Intergenic
902200517 1:14830123-14830145 CTTCAGGCACAGCTGGATCCAGG + Intronic
902257099 1:15196976-15196998 CTTCAGACACAGCGGGATCCAGG + Intronic
902438856 1:16416132-16416154 CTTGTGGCACAGATGGATGAAGG - Intronic
902669888 1:17965881-17965903 CTTCAGGCACAGCCTGATCCAGG - Intergenic
903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG + Intergenic
904416783 1:30366922-30366944 CTTCAGGCATGGCTGGATCCGGG + Intergenic
904658447 1:32067070-32067092 CTTCAGGTATAGTTGGATCCAGG + Intergenic
904777515 1:32920048-32920070 CTTTAGGCATGGTTAGATCCTGG + Intergenic
906137429 1:43509180-43509202 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
906638807 1:47428690-47428712 TTTCAGGCAGAGCTGGATCCAGG + Intergenic
907875050 1:58477762-58477784 CTTCAGGCACAGTTTAATCCAGG - Intronic
908038062 1:60077250-60077272 TTTCAGGCATAGCTGGATCCAGG - Intergenic
908790144 1:67773014-67773036 CTTCAGGCACAGCTGTATTCAGG - Intronic
909568371 1:77080667-77080689 CTTCAGGCTCAGCTTGATCCAGG - Intergenic
910228991 1:84967229-84967251 CTTCAGGAATAGCTGGATCCAGG - Intronic
912221109 1:107676540-107676562 CTTCAGGCAGAGATGGATCCAGG - Intronic
914334473 1:146701921-146701943 CTTCAGGCACAGCTTGATCCAGG + Intergenic
915255329 1:154624120-154624142 CTTCAGGCATGGCTGGATCCTGG - Intronic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
920106722 1:203558573-203558595 CTCCAGGCACAGCTAGATCCAGG + Intergenic
920904603 1:210150262-210150284 CTTCAGGCACTCATTGATCCAGG - Intronic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
1063121008 10:3105777-3105799 CTTCAGGCACTGTTGGCTCCAGG + Intronic
1063570758 10:7212738-7212760 CTGTAGGCACATATGCTTCCTGG - Intronic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1065244206 10:23741301-23741323 CTTGAGGCATGGCTGGATCCAGG - Intronic
1066757340 10:38723883-38723905 CTTCAGGCATAGTTGGATACAGG - Intergenic
1067249196 10:44573083-44573105 CTGCAGGCATAGCTGGATCCAGG - Intergenic
1067732113 10:48820067-48820089 CTTTATGAGCAGCTGGATCCTGG + Intronic
1069146695 10:64901602-64901624 ATTTAGGCACACTTGGATTCTGG + Intergenic
1069510376 10:69037706-69037728 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
1070466270 10:76726777-76726799 CTTTAGGCATTGCTTGATCCAGG - Intergenic
1070539334 10:77404972-77404994 TTTCAGGCACAGCTGGATCCGGG - Intronic
1071727471 10:88213987-88214009 CATTGGGCACAGCTGGATTCAGG + Intergenic
1071727667 10:88216333-88216355 CTTCAGGCACAGCTGGATCTAGG + Intergenic
1072247017 10:93552777-93552799 CTTTAGGCACATCTGGATCCAGG - Intergenic
1073438619 10:103538262-103538284 ATTTAGGCACAGATTTACCCTGG + Intronic
1074200156 10:111227444-111227466 CTTCAGGCATGGATGGATCCAGG + Intergenic
1074368393 10:112878610-112878632 CTTCAGGTACAGCTGAATCCAGG - Intergenic
1074369563 10:112888958-112888980 CTTCAGGCACAGCTGTATCCAGG - Intergenic
1075674462 10:124286787-124286809 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1076419979 10:130324437-130324459 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1077258867 11:1604783-1604805 CTGTAGCCCCAGATGGCTCCTGG - Intergenic
1079399954 11:20098831-20098853 CCTCAAGCACAGCTGGATCCAGG + Intronic
1079490319 11:20981882-20981904 CTTCAGGCAAAGCTGGATTCAGG + Intronic
1080210779 11:29782383-29782405 GAATAAGCACAGATGGATCCTGG + Intergenic
1081429131 11:42956682-42956704 CTTTAGGCATGTCTGGATCCAGG + Intergenic
1081687050 11:45050123-45050145 CTTCAGGTGCAGCTGGATCCAGG - Intergenic
1081703448 11:45166161-45166183 CTTCAGGTACAGTTGGATCCAGG + Intronic
1083313764 11:61801570-61801592 CTTTTGGCTCTGAAGGATCCTGG - Exonic
1084409484 11:68998150-68998172 CTTCAAGAACAGCTGGATCCAGG - Intergenic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1084494515 11:69496251-69496273 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
1084558401 11:69889061-69889083 CTCTAGACACACATGGATCTGGG - Intergenic
1084607893 11:70183187-70183209 CTTCAGGCATGGCTGGATCCAGG + Intronic
1084749324 11:71193784-71193806 CTGCAGGCACAGATTGTTCCAGG + Intronic
1085174763 11:74476097-74476119 CTTCAGGCACAGATTGATCCAGG - Intergenic
1085971213 11:81593123-81593145 CTTTAGGCATGGATGGATCCAGG + Intergenic
1086090703 11:83002075-83002097 CTTTGGGGTCAGATGGATCTAGG - Intronic
1086739992 11:90354699-90354721 CTTCAGGAACAGGTGGATCCTGG + Intergenic
1088743786 11:112787552-112787574 CTTCAGGCACAGTTTGATACAGG + Intergenic
1088860081 11:113790920-113790942 CTTTATGCACTGAGGGATCATGG - Intergenic
1089834050 11:121354370-121354392 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1092929643 12:13303764-13303786 TTTCAGGCACAGCTGGATCTAGG + Intergenic
1094787478 12:33865270-33865292 ATTTAGGCACAGATGGAACTTGG - Intergenic
1096107192 12:49003239-49003261 CTTTAGTCACAGATACATCTAGG + Exonic
1097735028 12:63173100-63173122 GTTTAGGCAAGGCTGGATCCTGG + Intergenic
1098368562 12:69733383-69733405 CTTCAGTCACAGGTTGATCCAGG + Intergenic
1098383819 12:69897745-69897767 CTTTAGGGTCAGAGAGATCCAGG - Intronic
1098641720 12:72846667-72846689 ATTTAGGCACAAATAAATCCAGG + Intergenic
1099985545 12:89658692-89658714 CTTTAGTCACTGATTGACCCAGG - Intronic
1100019067 12:90047919-90047941 CTTTAGGCACAGATGGCTCCAGG - Intergenic
1100745915 12:97645604-97645626 CTGTAGGCACATATGTATTCTGG + Intergenic
1101050983 12:100863946-100863968 CTTCAGGCACGGTTTGATCCAGG + Intronic
1101376904 12:104179007-104179029 CTTCAGGCACAGCTTGATCTAGG - Intergenic
1101377654 12:104184675-104184697 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1101403716 12:104410309-104410331 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101524001 12:105510974-105510996 CTTTAGTCATGGCTGGATCCAGG + Intergenic
1101579192 12:106026647-106026669 TTTCAGGCATAGCTGGATCCAGG - Intergenic
1101583118 12:106061488-106061510 TCTCAGGCACAGTTGGATCCAGG - Intergenic
1101738497 12:107481714-107481736 CCTTTGACACAGCTGGATCCAGG + Intronic
1101856380 12:108446799-108446821 TTTTGGGAACAGCTGGATCCAGG + Intergenic
1102175894 12:110874528-110874550 CTTCAGGCATAGCTGGATCCAGG + Intronic
1102402791 12:112644963-112644985 CTTCAGGTACAGCTGCATCCAGG - Intronic
1102513077 12:113428717-113428739 TTTCAGGCACAGGGGGATCCAGG + Intronic
1102525177 12:113507522-113507544 CTTCAGGCACAGTTGGATCCAGG + Intergenic
1102542573 12:113633202-113633224 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1102560381 12:113757815-113757837 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1102705409 12:114876172-114876194 CCTGAGGCAGAGATGGAGCCGGG + Intergenic
1102722563 12:115030176-115030198 CTTCAGGCATAGTTAGATCCAGG + Intergenic
1102888321 12:116538315-116538337 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1102891550 12:116562263-116562285 TTTCAGGCACAGGTGGATCCAGG - Intergenic
1102894993 12:116591826-116591848 CTTCAGGCACAACTGGATCAAGG - Intergenic
1103043741 12:117718002-117718024 CTTTAGGTACGGTTGGATCTAGG - Intronic
1103172815 12:118836158-118836180 GGTTAGGCAGAGATGGTTCCTGG + Intergenic
1103208087 12:119145850-119145872 CTTCAGGTACAGCTGGATTCAGG + Intronic
1103548469 12:121718839-121718861 CTTCAGGCAAGGCTGGATCCAGG + Intronic
1103794704 12:123495295-123495317 CTTCAGGTACAGCTGGCTCCAGG - Intronic
1103845692 12:123900710-123900732 CTTCAGGCACAGCTGGATCTAGG + Intronic
1103942661 12:124509396-124509418 CTTCAGGCACAGTTGGGTCCAGG - Intronic
1103975965 12:124702944-124702966 CTTCAGGTACAGCTGGATCCAGG + Intergenic
1103979266 12:124726021-124726043 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1103981609 12:124740408-124740430 CTTCAGGTACAGCTTGATCCGGG - Intergenic
1103982286 12:124744426-124744448 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1104055866 12:125229668-125229690 CTTCAGGCATAGCTGAATCCAGG + Intronic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104216632 12:126740273-126740295 CTTCAGGCTCAGATGGATTCAGG - Intergenic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1104362180 12:128144334-128144356 ATGTTGGCACAGATGGATCAGGG + Intergenic
1104377415 12:128277259-128277281 CTTCAGGCACAGCTGGATCCAGG + Intronic
1104391945 12:128398192-128398214 CTTCAGGCACTGCTGGATTCAGG + Intronic
1104420617 12:128631669-128631691 CTTCAGGCACAGTTGGTTCCAGG + Intronic
1104434515 12:128745178-128745200 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1104517978 12:129445613-129445635 CTTCAGGCACAGCTGGATCCAGG - Intronic
1104551604 12:129762114-129762136 CATCAGGAACAGATTGATCCAGG - Intronic
1104684720 12:130777415-130777437 CTTCAGACCCAGCTGGATCCTGG + Intergenic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104743726 12:131196998-131197020 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1104790613 12:131479715-131479737 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1104931922 12:132344295-132344317 CCTCGGGCACAGCTGGATCCAGG + Intergenic
1105352253 13:19626526-19626548 CTTAAGGCACAGATCGCTCATGG - Intergenic
1106016322 13:25872402-25872424 CTTCAGGCAGAGCTGGATCCAGG - Intronic
1106316386 13:28597779-28597801 CTTTAGGAAATGATGGAGCCAGG + Intergenic
1107903355 13:45040121-45040143 CTTTAGGCACAACTGGATCTGGG + Intergenic
1109349669 13:61161994-61162016 CTACAGGCACAGAAGGTTCCTGG + Intergenic
1109558180 13:64009035-64009057 CTTCAAGCACAGTTGGTTCCAGG - Intergenic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1117215382 14:53546320-53546342 CTTCGGGCACAGCTAGATCCAGG + Intergenic
1117343602 14:54812031-54812053 CATCAGGTACAGCTGGATCCAGG + Intergenic
1117538610 14:56725194-56725216 CTTTACCCACAGATGCATTCAGG + Intronic
1118702422 14:68446799-68446821 CCTGAGGCACAGTTGGATCCAGG - Intronic
1119507694 14:75187104-75187126 CTTCAGGCACAGCTGTGTCCAGG - Intergenic
1119531431 14:75364064-75364086 CTTTAGGAACAGCTGGATCCAGG + Intergenic
1119672702 14:76531518-76531540 CTTCAGGCACAGAATGATCAAGG - Intergenic
1119683670 14:76612890-76612912 ATTCAGGCACAGCTGGATCCGGG + Intergenic
1119723949 14:76910551-76910573 CTTCAGGCACAGTTTGATCTAGG - Intergenic
1119865194 14:77967305-77967327 CTTCAGGCATAGCAGGATCCAGG - Intergenic
1119867187 14:77983633-77983655 CTTTAGGCATGGCTGCATCCAGG - Intergenic
1120631325 14:86895018-86895040 CTTAAGGCACAGACTCATCCTGG + Intergenic
1122048091 14:99037615-99037637 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1122061922 14:99141621-99141643 CTTCAGGTACGGCTGGATCCAGG - Intergenic
1122416855 14:101554128-101554150 CTTCAGGCACGGCTGCATCCAGG - Intergenic
1123627393 15:22237230-22237252 CTTCAGGCACAACTGGATCCAGG - Intergenic
1124439992 15:29678686-29678708 CTTCAGGTGCAGCTGGATCCAGG + Intergenic
1128353699 15:66909414-66909436 CTATAGGCACGGAGGGATCAGGG + Intergenic
1128786917 15:70404354-70404376 CCTGAGGCACAGATGGATCCAGG - Intergenic
1129152089 15:73695750-73695772 CTTCAGGCATAGCTGGATCCAGG + Intronic
1129234187 15:74214023-74214045 CTCTAGGCAGAGCTGAATCCTGG - Intergenic
1130194777 15:81769041-81769063 CTTTAGGCAATGATGGAACATGG - Intergenic
1130606071 15:85318187-85318209 ATTCAGGTACAGCTGGATCCAGG - Intergenic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1131537871 15:93252656-93252678 GTTCAGGCACAGCTGGATCTAGG - Intergenic
1132104850 15:99055938-99055960 CTTCAGGCATAGCTTGATCCAGG - Intergenic
1132215318 15:100057878-100057900 CTTCAGGCACTGCTGGATCCAGG - Intronic
1132411300 15:101579988-101580010 CTTCAGGCATAGCTGGACCCAGG + Intergenic
1132657491 16:1047353-1047375 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1133338537 16:5022049-5022071 CTTCAGGTATAGCTGGATCCAGG + Intergenic
1133431461 16:5740610-5740632 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1133470829 16:6073906-6073928 CTTAAGGCACAGCATGATCCAGG + Intronic
1133532919 16:6672621-6672643 CTTCAGGTACACATGGATCCAGG + Intronic
1133661398 16:7921450-7921472 CTTAAGGTACAGCTGGATCCAGG - Intergenic
1134037384 16:11041420-11041442 CTTCAGGCAAAGCTGGATCCAGG + Intronic
1134040096 16:11061811-11061833 CTTCAGGCATGGCTGGATCCGGG + Intronic
1134124076 16:11604473-11604495 CTTCAGGCATGGCTGGATCCAGG + Intronic
1134396803 16:13872631-13872653 ATTCAGGAACAGCTGGATCCAGG - Intergenic
1134410712 16:14001263-14001285 CTTCGGGCACAGCTGGATCCAGG + Intergenic
1134862434 16:17572498-17572520 CTTAAGTCACAGAAGCATCCTGG - Intergenic
1135048843 16:19176091-19176113 CTTCAGGCATAGCTGGATCCAGG + Intronic
1135099458 16:19593576-19593598 CTTCAGGTGCAGCTGGATCCAGG + Intronic
1135248035 16:20873984-20874006 CTCTAGGAACAGTTGGATTCAGG - Intronic
1135479228 16:22807824-22807846 CTTTAGGCAAAACTGGATCCAGG + Intergenic
1135542817 16:23345442-23345464 CTTCAGGCATGGCTGGATCCAGG + Intronic
1135806113 16:25544454-25544476 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1135875623 16:26197383-26197405 CTTCAGGCATAGTTGGATCCAGG - Intergenic
1135978752 16:27129845-27129867 TTTCAGGCACAGTTGGATCCAGG + Intergenic
1136046202 16:27617229-27617251 CTTTAGGCATAGGTGAATCCAGG + Intronic
1136050406 16:27646184-27646206 CTTCAGGTGCAGCTGGATCCAGG + Intronic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1136084606 16:27875949-27875971 CTTCAGGCACAGCTGCATCCAGG - Intronic
1136086040 16:27885775-27885797 CTTCAGGAACAGCTGGAACCAGG - Intronic
1136089363 16:27907298-27907320 AGTCAGGCACAGCTGGATCCAGG - Intronic
1136092366 16:27929605-27929627 CTTCAGGCATGGCTGGATCCAGG - Intronic
1136105932 16:28030550-28030572 CTTCAGTCTCAGCTGGATCCAGG - Intronic
1136106593 16:28034461-28034483 CTTCAGTCTCAGCTGGATCCAGG + Intronic
1136251413 16:29008049-29008071 CTTCAGGAACAAGTGGATCCAGG - Intergenic
1136720182 16:32313842-32313864 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136725235 16:32352236-32352258 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136838558 16:33520118-33520140 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136843562 16:33558292-33558314 CTTCAGGCATAGCTGGATACAGG + Intergenic
1137374610 16:47941899-47941921 CTTCAGGCACAATTGGATCCAGG + Intergenic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1138071659 16:53998586-53998608 CTTCAGGCATAGCTTGATCCAGG + Intronic
1138346128 16:56321315-56321337 CTGCAGGCGCAGCTGGATCCAGG + Intronic
1138381450 16:56605659-56605681 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1138447285 16:57072099-57072121 CTTCAGGCACAGCTGGATCCAGG + Intronic
1138519953 16:57565429-57565451 CTTCAGACATAGCTGGATCCAGG + Intronic
1138600738 16:58052400-58052422 CTTTAGGCACGGCTGGATCCAGG - Intergenic
1139466647 16:67157575-67157597 CTTCAGGGACGGCTGGATCCAGG - Intronic
1139999148 16:71009311-71009333 CTTCAGGCACAGCTTGATCCAGG - Intronic
1140198574 16:72876268-72876290 CTTCAGCCACAGATGGCTCAGGG + Intronic
1140336437 16:74109323-74109345 CTTCAGGCACATTTGGTTCCAGG - Intergenic
1140855071 16:78970848-78970870 CTTCAGGCACGGCTGGATCCAGG + Intronic
1140863955 16:79043515-79043537 GTTCAGGCATAGCTGGATCCAGG + Intronic
1141157609 16:81608302-81608324 CTTCAGGCATTGCTGGATCCGGG + Intronic
1141251287 16:82361278-82361300 CTTCAGGCATAGTTAGATCCAGG - Intergenic
1141293943 16:82749236-82749258 CTTTAGGTACAGCTGGATCCAGG - Intronic
1141461921 16:84182861-84182883 GTTCAGGCACAGCTGCATCCAGG - Intronic
1141536501 16:84684775-84684797 CTTCAGGCATAGCTGTATCCAGG + Intergenic
1141946890 16:87316883-87316905 CTTCAGGCATGGATGTATCCAGG - Intronic
1141976564 16:87520148-87520170 CTTCAGGCGCAACTGGATCCAGG + Intergenic
1141988234 16:87593918-87593940 CTTCAGGTACTGCTGGATCCAGG + Intergenic
1142124806 16:88404968-88404990 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1142353508 16:89590609-89590631 CCTCAGGCACTGCTGGATCCAGG + Intronic
1203001195 16_KI270728v1_random:165518-165540 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203006249 16_KI270728v1_random:203927-203949 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203132798 16_KI270728v1_random:1701922-1701944 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203148722 16_KI270728v1_random:1820404-1820426 CTTCAGGCATAGCTGGATACAGG + Intergenic
1203153727 16_KI270728v1_random:1858590-1858612 CTTCAGGCATAGCTGGATACAGG + Intergenic
1143520759 17:7443018-7443040 AGTTAGGCACAGAGGGACCCAGG - Intronic
1143606363 17:7988705-7988727 CTTCAGGCACAGCTGGATTCAGG - Intergenic
1143606815 17:7991705-7991727 CTTCAGGCACAGCTGGATTCAGG + Intergenic
1143849257 17:9797440-9797462 AATTAGAAACAGATGGATCCTGG + Intronic
1144754817 17:17672973-17672995 CTTCAGGCGCAGCTGAATCCAGG + Intergenic
1144836731 17:18160348-18160370 CCTCAGGCATAGCTGGATCCAGG + Intronic
1146168056 17:30607213-30607235 TTTTAGGCACAGCTAGATCCCGG + Intergenic
1146221027 17:31020710-31020732 TTTTAGGCACAGCTGGATCCCGG + Intergenic
1146636629 17:34511251-34511273 CTTCAGGCACATCTGGATCCAGG + Intergenic
1146806813 17:35871424-35871446 CATTAGGCACACAGGGGTCCAGG - Intergenic
1146949667 17:36897121-36897143 CTTCAGGTGCAGCTGGATCCAGG + Intergenic
1149488058 17:57059882-57059904 CTTCAGACACAGTTGGATCCAGG - Intergenic
1149606595 17:57929366-57929388 CTTTGGGGTCAGATAGATCCAGG - Intronic
1149999041 17:61420936-61420958 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
1150340411 17:64362185-64362207 TTTTAGGCCCAGATGGGGCCAGG - Intronic
1150366726 17:64594425-64594447 TTTTAGGCACAGCTGGATCCCGG - Intronic
1151778512 17:76226180-76226202 CTTTATGCACTGAGGGATCATGG + Intronic
1154016106 18:10619365-10619387 CTTCAGGCCCAGATGGCTCTAGG + Intergenic
1154189407 18:12216276-12216298 CTTCAGGCCCAGATGGCTCTAGG - Intergenic
1154346767 18:13549061-13549083 CTTTTGTCACAAATGGATGCTGG + Intronic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1156370457 18:36467843-36467865 CTTTGGGCAGAGGTGGCTCCAGG + Intronic
1157797024 18:50583985-50584007 CTTTAGGCACAAATGCTTCAGGG + Intronic
1160678507 19:402964-402986 CTTCAGGCATAGCTGGATCCAGG + Intergenic
1160737577 19:671018-671040 GTTCAGGCACAGCTGGATCCAGG + Intergenic
1160758281 19:769755-769777 CTTCAGGCTCAGCTGGTTCCAGG + Intergenic
1160849953 19:1185871-1185893 TTTCAGACACAGCTGGATCCAGG + Intronic
1160926989 19:1551259-1551281 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1160938169 19:1607454-1607476 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1160943209 19:1629628-1629650 CTTCAGGCAAGGCTGGATCCAGG - Intronic
1161455179 19:4366376-4366398 CTTCAGGCACAGCTGGATCCCGG - Intronic
1161504057 19:4634559-4634581 CTTCAGGCACAGTTTGATCAAGG + Intergenic
1161579412 19:5072457-5072479 TCTTAGGCACAGGTGAATCCTGG + Intronic
1161616379 19:5273080-5273102 CTTCAGGTTCAGCTGGATCCAGG - Intronic
1161623881 19:5314417-5314439 CTTCAGGCATAGTTGGATCCAGG - Intronic
1161655816 19:5514208-5514230 CTTCAGGCACGGTTTGATCCAGG + Intergenic
1162055068 19:8057725-8057747 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1162496879 19:11028313-11028335 CTTCAGGCACAGCTGGATCCAGG + Intronic
1162522818 19:11192094-11192116 CTTCAGGCATGGCTGGATCCAGG - Intronic
1162556740 19:11391466-11391488 CTTCAGGCACAGTTGCATCCAGG - Intronic
1162882234 19:13668305-13668327 CTTCAGGCTCAGCTGGATCCAGG + Intergenic
1162928368 19:13942223-13942245 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163177125 19:15572172-15572194 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1163183338 19:15619110-15619132 CTTCAGGCACAACTGGATCCAGG + Intronic
1163186872 19:15644994-15645016 CTTCAGGCATGGCTGGATCCAGG + Intronic
1163201845 19:15775412-15775434 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1163217919 19:15894546-15894568 CTTCAGGCATGGCTGGATCCAGG - Intronic
1163221993 19:15928504-15928526 CTTCAGGCATGGTTGGATCCAGG - Intronic
1163535682 19:17874915-17874937 CTTCAGGCATGGCTGGATCCAGG + Intronic
1163654137 19:18535872-18535894 CTTCAGGCATAGCTGGATCCAGG - Intronic
1163668893 19:18616237-18616259 CTTCAGGCACAGCTGGATCCAGG + Intronic
1164464355 19:28474993-28475015 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1164669784 19:30065885-30065907 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1164678764 19:30120238-30120260 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1164916251 19:32054469-32054491 CTTCAGGTATAGCTGGATCCAGG - Intergenic
1165334695 19:35161296-35161318 CTTCAGGCATAGCTGGATCAAGG + Intronic
1165341546 19:35215809-35215831 CTTCAGGCACAGTTAGATCCAGG - Intergenic
1165419444 19:35715753-35715775 ATTTAGGGACAGTGGGATCCTGG - Exonic
1166104763 19:40591850-40591872 CTTCAGGCATGGCTGGATCCGGG + Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166683899 19:44783723-44783745 TTTCAGGCACAGCTAGATCCAGG + Intronic
1166770593 19:45279735-45279757 CTTCAGGCACAGTTGTATCCAGG + Intronic
1167010714 19:46805600-46805622 CTTCAGGCATAGCTGGCTCCAGG - Intergenic
1167090737 19:47341866-47341888 CTTCAGGCATAGCTGGATCCAGG + Exonic
1167097180 19:47380734-47380756 CTTCAGGCACAGCTGGATCCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167292010 19:48629699-48629721 CTACAGGCACAGATGCACCCTGG + Exonic
1167536184 19:50053334-50053356 CTTCAGGAACAGATGGATCCAGG - Intronic
1167536778 19:50058605-50058627 CTTCAGGAACAGATGGATCCAGG - Intergenic
1167540475 19:50083917-50083939 CTTCAGGCATAACTGGATCCAGG + Intergenic
1167567960 19:50268677-50268699 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567967 19:50268720-50268742 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567974 19:50268763-50268785 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167567982 19:50268806-50268828 CTTCAGGCATGGCTGGATCCAGG + Intronic
1167629232 19:50613880-50613902 CTTCAGGCATAACTGGATCCAGG - Intergenic
1167634747 19:50648048-50648070 CTTCAGGCATTGCTGGATCCAGG + Intronic
1167664283 19:50814565-50814587 CTTCAGGCATGGGTGGATCCAGG + Intergenic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1167745830 19:51351360-51351382 CTTCAGGCACAGCTTGATCCAGG - Intronic
1168244824 19:55107053-55107075 CTCTAGGCATAGCTTGATCCAGG - Intronic
927081114 2:19631473-19631495 CTTCAGGAACAGCTGGAACCAGG - Intergenic
929237174 2:39617758-39617780 GTTTAGGTACAGCTGGATCCAGG - Intergenic
930016182 2:46972067-46972089 CTTCAGGCAAAGCTGGATCTAGG + Intronic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930946700 2:57084483-57084505 CTTTAGGCACTGATGAGTACGGG - Intergenic
931992027 2:67800034-67800056 CTTAAGGCATAGATGGTGCCTGG + Intergenic
932224895 2:70031757-70031779 CTTAAGGCACAGTTAGATCCAGG + Intergenic
934320643 2:91968324-91968346 CTTCAGGCATAGCTGGATACAGG - Intergenic
934714307 2:96534737-96534759 CTGTAGGCACAGAGGCGTCCTGG + Intergenic
934985598 2:98882576-98882598 CTTCAGGAATAGCTGGATCCAGG - Intronic
936092090 2:109507994-109508016 CTTCAGGCATAGCTGGGTCCAGG + Intergenic
936462087 2:112721638-112721660 CTTCAGACACACATGGGTCCAGG + Intronic
936970309 2:118170427-118170449 CTTTACGGACACATGGTTCCTGG + Intergenic
938948737 2:136238154-136238176 CTTCAGGTAAAGATGGATCCAGG + Intergenic
939185622 2:138857175-138857197 CTTCAGGCACAACTGGATTCAGG - Intergenic
942555177 2:177165415-177165437 CTTTAGGAAAAGATGGCTCCTGG + Intergenic
944907133 2:204273400-204273422 CTTCAGGCATAGCTGGTTCCAGG + Intergenic
945631858 2:212288159-212288181 CCTTAAGCACAGATAGATCCAGG - Intronic
945948879 2:216020288-216020310 CTTTAGACATAACTGGATCCAGG + Intronic
947343185 2:229161342-229161364 AGTTAGACACAGCTGGATCCAGG - Intronic
948108063 2:235430899-235430921 CTTCAGGAACAGCTGGATCCAGG - Intergenic
948351610 2:237345594-237345616 CTTTAGACACGGAGGGAGCCAGG - Intronic
948460963 2:238129801-238129823 CTGTAGCCACAGGTGGCTCCTGG + Intronic
948558771 2:238836392-238836414 CTTCAGGCTTAGCTGGATCCAGG - Intergenic
948772125 2:240256997-240257019 TTTCAGGCACAGCTGGATCCAGG + Intergenic
948991159 2:241554770-241554792 TTTCAGGCATAGCTGGATCCAGG - Intergenic
1168842756 20:920295-920317 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1168928721 20:1604172-1604194 CTTGTGGCACAGACAGATCCAGG + Intronic
1168983793 20:2030073-2030095 CTTCAGGAACAGGTGGATCCAGG + Intergenic
1169190732 20:3657774-3657796 CTTCAGGCACAGCTGTCTCCAGG - Intergenic
1172043876 20:32065444-32065466 CCTCAGGCATAGCTGGATCCAGG + Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172627478 20:36356196-36356218 CTTCAGGCACAGTTGAATCAGGG - Intronic
1172630187 20:36373251-36373273 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1172692867 20:36802702-36802724 CTTCAGGTATAGCTGGATCCAGG - Intronic
1172906217 20:38371657-38371679 TTTCAGGCATAGCTGGATCCAGG + Intronic
1173455634 20:43199154-43199176 CTTCAGGCAAAGCTGGATCTAGG + Intergenic
1173665339 20:44758919-44758941 CTTCAGGCAGAGCTTGATCCAGG - Intronic
1173942320 20:46921779-46921801 CTTCAGGAACAGCTGGATCCAGG - Intronic
1174078516 20:47954733-47954755 CTACAGGCACAGCTGGATCTTGG - Intergenic
1174085219 20:48003199-48003221 CTTCAGGCATGGATGGATCCAGG + Intergenic
1174096860 20:48096612-48096634 CTTTGGGCACAGCTGCATTCAGG + Intergenic
1174113667 20:48212989-48213011 CTTCAGGCACAGCTGCATCCAGG + Intergenic
1174129397 20:48331664-48331686 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1174168188 20:48599552-48599574 CTTCAGGCACAGCTGCATCCAGG - Intergenic
1174187499 20:48716957-48716979 CTTCAGGCATAGCTGCATCCAGG - Intronic
1174190613 20:48737885-48737907 CTTCAGGCATAGCTAGATCCAGG - Intronic
1174200573 20:48803843-48803865 CCTCAGGCACAGTTGGATCCAGG - Intronic
1174327251 20:49789256-49789278 CTTCAGGTACAGCTGGATTCAGG - Intergenic
1174412873 20:50347204-50347226 CTTCAGATACAGCTGGATCCAGG - Intergenic
1174413987 20:50355101-50355123 CTTCAGGCATAGCTAGATCCAGG + Intergenic
1174451221 20:50621732-50621754 CTTTAGACATAGCTAGATCCAGG - Intronic
1174518219 20:51109606-51109628 CTTCAGGCATGGATGGATCCAGG - Intergenic
1174540269 20:51283867-51283889 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1174582373 20:51580958-51580980 CTTCAGGCACAGCTGTATGCAGG - Intergenic
1174703561 20:52633867-52633889 CTTCAGGCATAGTGGGATCCAGG - Intergenic
1174731139 20:52918781-52918803 AATTAGGCATAGCTGGATCCAGG - Intergenic
1174734065 20:52947584-52947606 CTTTGGGCATAGCTGGATCCAGG - Intergenic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175118195 20:56698699-56698721 CTTCAGGTACAGCTGGATCCGGG + Intergenic
1175119354 20:56706442-56706464 CTTTAGGGAAAGCTGGATGCAGG + Intergenic
1175122322 20:56725276-56725298 CTTCAGGCACGGCTGGATCCAGG + Intergenic
1175134426 20:56812289-56812311 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1175228460 20:57459163-57459185 CTTCAGGCACAGATGGATCCAGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175380241 20:58557783-58557805 CTTCAGGCATGGTTGGATCCGGG - Intergenic
1175609877 20:60341907-60341929 CTCTGGGATCAGATGGATCCAGG + Intergenic
1175677823 20:60961914-60961936 CTTTAGGCTCGGCTGGATCCAGG + Intergenic
1175721610 20:61290886-61290908 CTTCAGGCATGGCTGGATCCAGG + Intronic
1175831335 20:61966678-61966700 CTTCAGGCACGGCTGGATCCAGG + Intronic
1175831342 20:61966708-61966730 CCTCAGGCACGGCTGGATCCAGG + Intronic
1175870990 20:62209397-62209419 CTTCAGGCAGGGTTGGATCCAGG + Intergenic
1175876226 20:62231493-62231515 CTTCAGGCATGGTTGGATCCAGG + Intergenic
1176119806 20:63449200-63449222 CTTCAGGCACAGCTGGATCCAGG - Intronic
1178557998 21:33610685-33610707 CTTTAGGCACTGATGAACACTGG - Intronic
1179103956 21:38381796-38381818 CTTTTGGAACAGAAGGACCCCGG - Exonic
1180007601 21:45030147-45030169 CTCTAATCACAGATGGTTCCCGG + Intergenic
1180037141 21:45255843-45255865 CCTCAGGCACGGCTGGATCCAGG - Intergenic
1180173384 21:46073595-46073617 CTCCAGGCCCAGATGGCTCCTGG + Intergenic
1180308892 22:11152383-11152405 CTTCAGGCATAGCTGGATACAGG - Intergenic
1180547369 22:16514194-16514216 CTTCAGGCATAGCTGGATACAGG - Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181298100 22:21858343-21858365 CTTTAGGTATAGTTGGAACCAGG - Intronic
1181733782 22:24866532-24866554 CTTCAGGCATGGATGGATCCAGG + Intronic
1181744656 22:24947563-24947585 CTTCAGGCATAGTGGGATCCAGG + Intergenic
1181961961 22:26628649-26628671 CTTCAAGCATAGCTGGATCCAGG + Intronic
1182211795 22:28683140-28683162 CTTCAGGCATAGCTGGATACAGG + Intergenic
1182230859 22:28836592-28836614 CTTCAAGTACAAATGGATCCAGG + Intergenic
1182533231 22:30978764-30978786 CTTCAGGCACGGTTGGATCCAGG - Intergenic
1182756547 22:32684364-32684386 CTTCAGGCACAGCTGGATCTAGG - Intronic
1182884174 22:33759151-33759173 CTTCAGGCAGAGTTGGATCCAGG - Intronic
1183077757 22:35437510-35437532 CTTCAGGCTTAGCTGGATCCAGG - Intergenic
1183232934 22:36594088-36594110 CTTCAGGCACAGATGGATCCAGG + Intronic
1183261737 22:36799809-36799831 CTTCAGGAACAGCTGGATCAAGG - Intergenic
1183713854 22:39522151-39522173 CTTTATGCACTGAGGGATCATGG - Exonic
1184092231 22:42298891-42298913 CTTGAGGCAGGGATGGCTCCTGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949876078 3:8626855-8626877 CTTCAGGCCCAGCTGGATCCGGG - Intronic
949921821 3:9009049-9009071 CTTCAGGCACAGCTGGATCCAGG - Intronic
950047814 3:9960879-9960901 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
950132761 3:10558578-10558600 CTTCAGGCACAGCTGGATCCAGG - Intronic
950441036 3:13010594-13010616 CTTCAGGTACAGTTGGATTCGGG - Intronic
950532310 3:13559294-13559316 CTTCAGGCATGGCTGGATCCAGG + Intronic
951843339 3:27058620-27058642 ATTTAGGTCCAGATGGATTCAGG + Intergenic
952333797 3:32387733-32387755 CTTCAGGCATGGCTGGATCCAGG - Intergenic
952814369 3:37434471-37434493 CTTCAGGCACAGCTCAATCCAGG - Intronic
953361819 3:42303890-42303912 ATTCAGGCATAGATGGATTCAGG - Intergenic
955003537 3:54948969-54948991 CTTCAGGTACAGTTGGATCTGGG + Intronic
955047881 3:55376943-55376965 CTTCAGGCATGGCTGGATCCAGG + Intergenic
955081043 3:55658127-55658149 CTTTGGGCACAGGTGAATTCGGG + Intronic
955198281 3:56826203-56826225 CTTCAGGCATGGCTGGATCCAGG - Intronic
955212336 3:56953858-56953880 CTTCAGGCACAGCTGTTTCCAGG - Intronic
955215518 3:56982186-56982208 CTTCAGGCATAGCTCGATCCAGG - Intronic
955352003 3:58200494-58200516 CTTCAGGCATAGCTGGATCCAGG - Intronic
955472836 3:59303828-59303850 CTTTTGGTAGAGATGGATTCTGG - Intergenic
955511484 3:59685327-59685349 CTTCAGGCACAGATGGATCCAGG + Intergenic
955527156 3:59832911-59832933 CTTCAGGCACAGCTGGATTCAGG - Intronic
955624479 3:60902750-60902772 CTTTAGGCATGTCTGGATCCAGG - Intronic
955835926 3:63055150-63055172 TTTCAGGCACAGTTAGATCCAGG + Intergenic
955999061 3:64709439-64709461 CTTCAGGCACAGTTGGATCCAGG + Intergenic
956297016 3:67726015-67726037 CTTGAGGCACAGGTGGATCTAGG + Intergenic
956547157 3:70417570-70417592 CTTCAGACATAGGTGGATCCAGG + Intergenic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
956668623 3:71664966-71664988 CTTCAGGCACAGCTTGATCCAGG - Intergenic
956722885 3:72133818-72133840 CTTCAGGTATAGCTGGATCCAGG + Intergenic
956731762 3:72203289-72203311 CTTCAGGCATAGCTGTATCCAGG + Intergenic
956894350 3:73644545-73644567 CTTCAGGCACAGATGGATTCAGG - Intergenic
956900862 3:73714610-73714632 CTTTAGGCATAACTGGATCTAGG - Intergenic
957005654 3:74943675-74943697 CTTCAGGCACAGCTGTGTCCAGG - Intergenic
959111827 3:102132007-102132029 CCTTAGGCACTGATGGATCCTGG + Intronic
959477222 3:106825590-106825612 CTTTAGGCAATGCTGGATACAGG - Intergenic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
961469062 3:127100180-127100202 CTTCAGGCATGGCTGGATCCAGG + Intergenic
961515315 3:127428752-127428774 CTTCAGGCACAGCTGGATCCAGG + Intergenic
961517655 3:127448209-127448231 CTTCTGGCACAGCTGGATCCAGG + Intergenic
961541072 3:127599659-127599681 CTTTGAGCACAGCTTGATCCAGG + Intronic
961599007 3:128044268-128044290 CTTTAGGCAAAGATGGATTTAGG - Intergenic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
961651060 3:128416860-128416882 CTCCAGGCATAGCTGGATCCAGG - Intergenic
961741285 3:129034580-129034602 CTTCAGGCACAGCTGGGTCCAGG + Intronic
962395865 3:135014983-135015005 CTTTAGGAACAAAAGGACCCTGG + Intronic
962756284 3:138467750-138467772 GGTGAGGCACAGATGGCTCCAGG + Intronic
963651190 3:147982314-147982336 CTTCAGACACACTTGGATCCAGG + Intergenic
963710678 3:148744234-148744256 TTTCAGGCACAGTTGCATCCTGG - Intergenic
964122311 3:153198045-153198067 ATTTTGGCAGCGATGGATCCAGG + Intergenic
964807145 3:160622890-160622912 CTTCAGGGACAGATGAATCCAGG - Intergenic
965616318 3:170596384-170596406 CTTCAGGCATAGCTGGGTCCAGG + Intronic
969245152 4:5927152-5927174 CTCCAGGCACAGCTGGCTCCAGG - Intronic
969298500 4:6283452-6283474 CTTCAGGCACGGCTGGATCCAGG + Intronic
969630223 4:8331514-8331536 ATCCAGGCACGGATGGATCCAGG - Intergenic
970652149 4:18190705-18190727 CTTTAGCCACAGATACTTCCTGG - Intergenic
971370113 4:26012153-26012175 CTTCAGGCACAGCTCAATCCAGG - Intergenic
972027215 4:34397672-34397694 CTTTAGGTACAAAAGAATCCAGG - Intergenic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
975543991 4:75543358-75543380 CTTCAGGTACAGCTGGATCTAGG + Intronic
975618334 4:76270108-76270130 CTTCAGGCACAGCTGGATCCAGG + Intronic
975856200 4:78627268-78627290 CTTTAGGCACAGCTGGATTCAGG + Intergenic
976331377 4:83834713-83834735 CTTTAGCCACAGATGCATCTTGG + Intergenic
976832222 4:89328407-89328429 CTTCAGGCACAGGTTGATCCAGG + Intergenic
977918852 4:102622325-102622347 ACTTAGCCACACATGGATCCAGG + Intergenic
981035609 4:140165424-140165446 CTTTAGGCTCAGCTGGATCCAGG - Intergenic
982265251 4:153532940-153532962 CTTCAGGCACAGGTGGATTTAGG + Intronic
985179916 4:187248557-187248579 CTTTAGTGACAGTTGGCTCCAGG - Intergenic
985948404 5:3204162-3204184 CTTCAGGCACAGCTGTACCCAGG - Intergenic
987055329 5:14185542-14185564 ACTTAGGCAGAGATGGCTCCTGG + Intronic
990818319 5:59809872-59809894 CTCTAGGCAGAGATGGACCCCGG - Intronic
990893716 5:60674931-60674953 CTTTAGGACCAGATTGTTCCTGG - Intronic
990973180 5:61532247-61532269 CATTAGGCACAGATTCATCAAGG + Intronic
992358028 5:76005805-76005827 CTTCAGGTTCAGCTGGATCCAGG - Intergenic
992385895 5:76284528-76284550 TTTGAGGCACAGGTGGATCCAGG - Intronic
992387285 5:76297336-76297358 CTTTAGACACAGAATGCTCCTGG + Intronic
993165351 5:84346909-84346931 CTTCAAACACAGGTGGATCCAGG - Intronic
993175905 5:84484966-84484988 TTTTAGGCAGAGATTGATGCTGG + Intergenic
994074620 5:95636646-95636668 CTTCAGGCAGAGCTGGATCCAGG + Intergenic
995713270 5:115055856-115055878 CTTTAGGAACAGATGAGTCTGGG + Intergenic
995748963 5:115433984-115434006 CTTTAGGCAAGGCTGGATCCAGG + Intergenic
997516683 5:134495014-134495036 CTTCAGGCACAGTTTGATCCAGG - Intergenic
997726743 5:136127251-136127273 CTTCAGGTACAGCTGGATCCAGG + Intergenic
998765040 5:145477217-145477239 CTTCAGGTACAGCTGGATCCAGG + Intronic
999145914 5:149393754-149393776 CTTTAGGTATGGCTGGATCCAGG - Intronic
999233140 5:150074183-150074205 CTTCAGGAACACTTGGATCCAGG - Intronic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
999667203 5:153925316-153925338 CTTTAGGCATAGCTGGATCCAGG - Intergenic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
1000278372 5:159760450-159760472 CTTCAGGCACAGATGGGTTCAGG - Intergenic
1000375335 5:160575858-160575880 CTTCAGGCAAAGCTGGATGCAGG + Intronic
1000810411 5:165854499-165854521 CTTCAGGCACAGCTAGATCCAGG - Intergenic
1001050661 5:168411524-168411546 CTTCAGGCACAGCTGGATCCAGG + Intronic
1001146625 5:169190374-169190396 CTTCAGGAACAGCTGGATCCAGG - Intronic
1001198762 5:169697186-169697208 CTTCAGGCATAGCTGGATCCAGG + Intronic
1001404093 5:171463377-171463399 CTTCAGGCAAAGCTGGATCCAGG + Intergenic
1001441186 5:171744238-171744260 CTTCAGGAACTGATGGATCCAGG + Intergenic
1001452817 5:171839273-171839295 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1001486632 5:172124252-172124274 CTTCAGGCACAGCTTGTTCCAGG - Intronic
1001554222 5:172625265-172625287 CTTTGGGCACAGAAAGATCTGGG + Intergenic
1001564981 5:172694210-172694232 CTTCAGGAACAGCTAGATCCGGG + Intergenic
1001585072 5:172828279-172828301 TTTCAGGCACAGTTGGATACAGG - Intergenic
1001669207 5:173460067-173460089 ATTCAGGCATAGCTGGATCCAGG + Intergenic
1001757526 5:174182009-174182031 CTTCAGGCTCAGCTGGATCCAGG + Intronic
1001966877 5:175916102-175916124 CTTCAGGCATGGCTGGATCCAGG + Intergenic
1002051108 5:176571958-176571980 CTTCAGGCATGGCTGGATCCAGG + Intronic
1002080631 5:176735200-176735222 CTTCAGGCCCAGCTGGATCCAGG - Intergenic
1002082745 5:176747358-176747380 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1002087027 5:176782412-176782434 CATGAGGCACAGCTGGATTCAGG + Intergenic
1002129688 5:177072849-177072871 CTTCAGGCATAGCTGGATCCAGG - Intronic
1002250069 5:177923104-177923126 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1002534982 5:179871137-179871159 CTTCAGGCATGGCTGGATCCAGG - Intronic
1003977142 6:11354965-11354987 CTTCAGGCACAAGTGGATACAGG - Intronic
1004262978 6:14124415-14124437 CTTTAGGAAAAGAAGGATGCTGG + Intronic
1004649099 6:17591386-17591408 TTTCAGGCATAGTTGGATCCAGG + Intergenic
1007040054 6:38713729-38713751 CTTTTGGCACTGATGGAGCTGGG - Intergenic
1008474932 6:51926329-51926351 CTTGAGGCACAGCTGAGTCCAGG - Intronic
1009518043 6:64644224-64644246 TTTCAAGCACAGCTGGATCCAGG - Intronic
1009607412 6:65891116-65891138 CTTCAGGCTTAGCTGGATCCAGG + Intergenic
1012937655 6:105384896-105384918 CTTTAGGCACAGTCTGATCCAGG - Intronic
1013870965 6:114759133-114759155 CTTCAGGCACACATGGCTCTTGG + Intergenic
1014037591 6:116785399-116785421 CTTTAGGCACAGCTAAATCAGGG + Intergenic
1018262463 6:161984211-161984233 CATCAGGCATAGCTGGATCCAGG - Intronic
1018862528 6:167721385-167721407 CTTCAGGCGCGGATGAATCCAGG - Intergenic
1019324874 7:433111-433133 CTTCAGGCACGGCTGGATTCAGG - Intergenic
1019356904 7:585007-585029 CTTCAGGCACGGCTGGATCCAGG - Intronic
1019516497 7:1442504-1442526 CATCAGGCACAGCTGGATCCAGG + Intronic
1020119777 7:5496465-5496487 CTTTAGCCACCTATGGATCCAGG - Intronic
1020264917 7:6553871-6553893 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1020728033 7:11841729-11841751 GCTTAGGCCCACATGGATCCAGG - Intergenic
1022909589 7:34887758-34887780 CCTTAGGCCCAGCTGAATCCAGG + Intergenic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1025206668 7:56997002-56997024 CTTCAGGCATGGTTGGATCCAGG + Intergenic
1025213229 7:57033276-57033298 CTTCAGGCACGGCTGCATCCAGG + Intergenic
1025658724 7:63543548-63543570 CTTCAGGCACGGCTGCATCCAGG - Intergenic
1025665272 7:63579925-63579947 CTTCAGGCATGGTTGGATCCAGG - Intergenic
1026945516 7:74313595-74313617 CTTCAGGCTCAGCTGGATCTAGG + Intronic
1027743425 7:82041294-82041316 AGGTAGGGACAGATGGATCCAGG + Intronic
1028364460 7:90011241-90011263 ATTCAGGCACAGCTGGATCCAGG - Intergenic
1028452959 7:91006000-91006022 CTATAGGCAGTGATGGCTCCAGG + Intronic
1029148223 7:98461958-98461980 CTTTAGGCATAGCTGTATCCAGG - Intergenic
1031163741 7:118201406-118201428 CTTTAGGCATCGCTGGATCCAGG - Intergenic
1031342627 7:120622778-120622800 GTTTAGCCACAGATGTATACAGG - Intronic
1031605885 7:123767392-123767414 CTTCAGGCTTAGCTGGATCCAGG + Intergenic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1037191177 8:16127737-16127759 CTTCAGGCATAGCAGGATCCAGG - Intronic
1038258108 8:25969705-25969727 GTTTGGGGACAGATGGATCCAGG + Intronic
1039066200 8:33610476-33610498 CTTTGGGCACACTTGGCTCCTGG - Intergenic
1041195977 8:55401668-55401690 CTTTGGCCCCAGATGGACCCAGG - Intronic
1042385474 8:68169054-68169076 CTTCAGGCACAGCTCTATCCAGG + Intronic
1043375433 8:79644244-79644266 CATCAGGAACAGCTGGATCCAGG + Intronic
1044871865 8:96627654-96627676 CTTCAGGCACAGCTGGATCTTGG + Intergenic
1045831934 8:106472226-106472248 CTTTTTGCACAAATGCATCCTGG - Intronic
1046716514 8:117573757-117573779 CTTCAGGCACAGCTGTAACCAGG - Intergenic
1046833431 8:118773300-118773322 CTTTTGGCACAACTGGATTCAGG - Intergenic
1047716522 8:127600604-127600626 TTTCAGGGACAGATGGATCCAGG + Intergenic
1047728956 8:127709995-127710017 CTTCAGGTACAGTTGGATCAAGG - Intergenic
1047816281 8:128467004-128467026 CTTTAGGCACTGGTAGTTCCAGG - Intergenic
1047974825 8:130119647-130119669 ATTCAGGTACAGCTGGATCCAGG - Intronic
1048066848 8:130978967-130978989 CTTCAGGCACAGCTTGGTCCAGG - Intronic
1048491714 8:134900467-134900489 CTTCAGGCACAGCTAGATCCAGG + Intergenic
1048503111 8:134996686-134996708 CTTTAGGCAAAGCTGGATTCCGG + Intergenic
1051437348 9:17047231-17047253 TTTCAGGCATAGCTGGATCCAGG + Intergenic
1051606320 9:18920783-18920805 CTTTAGGCATAGCTGGAACCAGG - Intergenic
1052273958 9:26657353-26657375 CTTCAGGCACCACTGGATCCAGG + Intergenic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1052606363 9:30707704-30707726 CTTAAGGCACAGATTGCTCATGG + Intergenic
1054883715 9:70173027-70173049 CTTCAGGCACAGCTTGATGCAGG + Intronic
1056948779 9:91025227-91025249 TTTTAGGGACAGAGGGATCAGGG + Intergenic
1057522353 9:95770087-95770109 CTTCAGGCACAGCTGGATCTAGG - Intergenic
1057608330 9:96518084-96518106 ATTTGGTCACAGATGTATCCAGG - Intronic
1057820971 9:98330429-98330451 CTTCAGGCACAGTTTGATCAGGG - Intronic
1057891526 9:98873651-98873673 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1058410258 9:104724096-104724118 CTTTAGACACAGCTGAATCGAGG - Intergenic
1058533365 9:105929395-105929417 CTTCAGGCATAGTTGAATCCAGG + Intergenic
1058670732 9:107358702-107358724 CTTCAGGCACAGCTAGATTCAGG - Intergenic
1058727207 9:107815695-107815717 CTTTAGGTGCAGCTGGATTCAGG + Intergenic
1059367970 9:113801355-113801377 CTTTAGGTAGGGCTGGATCCAGG + Intergenic
1059586022 9:115607184-115607206 CTTTAGGCTCAGGTTAATCCAGG - Intergenic
1060475086 9:123980845-123980867 CTTTGGGATCAGATAGATCCAGG - Intergenic
1061207280 9:129172145-129172167 CTTCAGGCACAGCAGGATCCAGG - Intergenic
1061297415 9:129684309-129684331 CTTCAGGCACTGCTGGATCCAGG + Intronic
1061417097 9:130453032-130453054 CTTCAGGCAGGGCTGGATCCAGG + Intronic
1185627425 X:1492583-1492605 CTTCAGGCATGGCTGGATCCAGG - Intronic
1186615601 X:11184089-11184111 ATTTAGGCACGGCTGGATCCAGG - Intronic
1187336750 X:18388244-18388266 CTTCAGGCATGGAGGGATCCAGG - Intergenic
1187561471 X:20407412-20407434 CTTCAGGCATGGCTGGATCCAGG - Intergenic
1188413294 X:29900856-29900878 CTAGAGGCACTGATGGATACAGG + Intronic
1192129983 X:68540724-68540746 CTTCAGGCACAGCTGGACTCAGG - Intergenic
1194665206 X:96670421-96670443 GTCAAGGCACAGAGGGATCCAGG - Intergenic
1194769063 X:97878073-97878095 CTTTAGACACAGATGCATTCAGG - Intergenic
1196885684 X:120243336-120243358 CTTAAGGCACAGATAAAACCAGG - Intergenic
1200793682 Y:7321445-7321467 CTTGAGGCATAAAGGGATCCAGG - Intergenic