ID: 1167703649

View in Genome Browser
Species Human (GRCh38)
Location 19:51065721-51065743
Sequence AATGCTGAGTGAGCTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703649_1167703660 14 Left 1167703649 19:51065721-51065743 CCTCCCCCAGCTCACTCAGCATT No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703649_1167703665 22 Left 1167703649 19:51065721-51065743 CCTCCCCCAGCTCACTCAGCATT No data
Right 1167703665 19:51065766-51065788 CTCCACCCCCAGTGGCTCAGCGG No data
1167703649_1167703655 -10 Left 1167703649 19:51065721-51065743 CCTCCCCCAGCTCACTCAGCATT No data
Right 1167703655 19:51065734-51065756 ACTCAGCATTTCCTGGTCCCTGG No data
1167703649_1167703666 23 Left 1167703649 19:51065721-51065743 CCTCCCCCAGCTCACTCAGCATT No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703649 Original CRISPR AATGCTGAGTGAGCTGGGGG AGG (reversed) Intergenic
No off target data available for this crispr