ID: 1167703650

View in Genome Browser
Species Human (GRCh38)
Location 19:51065724-51065746
Sequence GGAAATGCTGAGTGAGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703650_1167703665 19 Left 1167703650 19:51065724-51065746 CCCCCAGCTCACTCAGCATTTCC No data
Right 1167703665 19:51065766-51065788 CTCCACCCCCAGTGGCTCAGCGG No data
1167703650_1167703666 20 Left 1167703650 19:51065724-51065746 CCCCCAGCTCACTCAGCATTTCC No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703650_1167703660 11 Left 1167703650 19:51065724-51065746 CCCCCAGCTCACTCAGCATTTCC No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703650 Original CRISPR GGAAATGCTGAGTGAGCTGG GGG (reversed) Intergenic
No off target data available for this crispr