ID: 1167703652

View in Genome Browser
Species Human (GRCh38)
Location 19:51065726-51065748
Sequence CAGGAAATGCTGAGTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703652_1167703665 17 Left 1167703652 19:51065726-51065748 CCCAGCTCACTCAGCATTTCCTG No data
Right 1167703665 19:51065766-51065788 CTCCACCCCCAGTGGCTCAGCGG No data
1167703652_1167703666 18 Left 1167703652 19:51065726-51065748 CCCAGCTCACTCAGCATTTCCTG No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703652_1167703660 9 Left 1167703652 19:51065726-51065748 CCCAGCTCACTCAGCATTTCCTG No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703652_1167703672 29 Left 1167703652 19:51065726-51065748 CCCAGCTCACTCAGCATTTCCTG No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703652 Original CRISPR CAGGAAATGCTGAGTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr