ID: 1167703658

View in Genome Browser
Species Human (GRCh38)
Location 19:51065752-51065774
Sequence GGGGTGGAGAGGGGGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703658_1167703673 17 Left 1167703658 19:51065752-51065774 CCTGGCCTCCCCCTCTCCACCCC No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703658_1167703666 -8 Left 1167703658 19:51065752-51065774 CCTGGCCTCCCCCTCTCCACCCC No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703658_1167703665 -9 Left 1167703658 19:51065752-51065774 CCTGGCCTCCCCCTCTCCACCCC No data
Right 1167703665 19:51065766-51065788 CTCCACCCCCAGTGGCTCAGCGG No data
1167703658_1167703676 23 Left 1167703658 19:51065752-51065774 CCTGGCCTCCCCCTCTCCACCCC No data
Right 1167703676 19:51065798-51065820 AGGCACCCCCGACCTGGGCTTGG No data
1167703658_1167703672 3 Left 1167703658 19:51065752-51065774 CCTGGCCTCCCCCTCTCCACCCC No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703658_1167703674 18 Left 1167703658 19:51065752-51065774 CCTGGCCTCCCCCTCTCCACCCC No data
Right 1167703674 19:51065793-51065815 TCTCCAGGCACCCCCGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703658 Original CRISPR GGGGTGGAGAGGGGGAGGCC AGG (reversed) Intergenic
No off target data available for this crispr