ID: 1167703659

View in Genome Browser
Species Human (GRCh38)
Location 19:51065757-51065779
Sequence CACTGGGGGTGGAGAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703659_1167703672 -2 Left 1167703659 19:51065757-51065779 CCTCCCCCTCTCCACCCCCAGTG No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703659_1167703682 30 Left 1167703659 19:51065757-51065779 CCTCCCCCTCTCCACCCCCAGTG No data
Right 1167703682 19:51065810-51065832 CCTGGGCTTGGCCCTCTGCTTGG No data
1167703659_1167703674 13 Left 1167703659 19:51065757-51065779 CCTCCCCCTCTCCACCCCCAGTG No data
Right 1167703674 19:51065793-51065815 TCTCCAGGCACCCCCGACCTGGG No data
1167703659_1167703673 12 Left 1167703659 19:51065757-51065779 CCTCCCCCTCTCCACCCCCAGTG No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703659_1167703676 18 Left 1167703659 19:51065757-51065779 CCTCCCCCTCTCCACCCCCAGTG No data
Right 1167703676 19:51065798-51065820 AGGCACCCCCGACCTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703659 Original CRISPR CACTGGGGGTGGAGAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr