ID: 1167703660

View in Genome Browser
Species Human (GRCh38)
Location 19:51065758-51065780
Sequence CTCCCCCTCTCCACCCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703645_1167703660 25 Left 1167703645 19:51065710-51065732 CCCCTGAACTCCCTCCCCCAGCT No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703646_1167703660 24 Left 1167703646 19:51065711-51065733 CCCTGAACTCCCTCCCCCAGCTC No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703652_1167703660 9 Left 1167703652 19:51065726-51065748 CCCAGCTCACTCAGCATTTCCTG No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703648_1167703660 15 Left 1167703648 19:51065720-51065742 CCCTCCCCCAGCTCACTCAGCAT No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703653_1167703660 8 Left 1167703653 19:51065727-51065749 CCAGCTCACTCAGCATTTCCTGG No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703650_1167703660 11 Left 1167703650 19:51065724-51065746 CCCCCAGCTCACTCAGCATTTCC No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703649_1167703660 14 Left 1167703649 19:51065721-51065743 CCTCCCCCAGCTCACTCAGCATT No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703656_1167703660 -10 Left 1167703656 19:51065745-51065767 CCTGGTCCCTGGCCTCCCCCTCT No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703651_1167703660 10 Left 1167703651 19:51065725-51065747 CCCCAGCTCACTCAGCATTTCCT No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data
1167703647_1167703660 23 Left 1167703647 19:51065712-51065734 CCTGAACTCCCTCCCCCAGCTCA No data
Right 1167703660 19:51065758-51065780 CTCCCCCTCTCCACCCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703660 Original CRISPR CTCCCCCTCTCCACCCCCAG TGG Intergenic
No off target data available for this crispr