ID: 1167703662

View in Genome Browser
Species Human (GRCh38)
Location 19:51065761-51065783
Sequence GAGCCACTGGGGGTGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703662_1167703684 28 Left 1167703662 19:51065761-51065783 CCCCTCTCCACCCCCAGTGGCTC No data
Right 1167703684 19:51065812-51065834 TGGGCTTGGCCCTCTGCTTGGGG No data
1167703662_1167703672 -6 Left 1167703662 19:51065761-51065783 CCCCTCTCCACCCCCAGTGGCTC No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703662_1167703676 14 Left 1167703662 19:51065761-51065783 CCCCTCTCCACCCCCAGTGGCTC No data
Right 1167703676 19:51065798-51065820 AGGCACCCCCGACCTGGGCTTGG No data
1167703662_1167703682 26 Left 1167703662 19:51065761-51065783 CCCCTCTCCACCCCCAGTGGCTC No data
Right 1167703682 19:51065810-51065832 CCTGGGCTTGGCCCTCTGCTTGG No data
1167703662_1167703673 8 Left 1167703662 19:51065761-51065783 CCCCTCTCCACCCCCAGTGGCTC No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703662_1167703683 27 Left 1167703662 19:51065761-51065783 CCCCTCTCCACCCCCAGTGGCTC No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703662_1167703674 9 Left 1167703662 19:51065761-51065783 CCCCTCTCCACCCCCAGTGGCTC No data
Right 1167703674 19:51065793-51065815 TCTCCAGGCACCCCCGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703662 Original CRISPR GAGCCACTGGGGGTGGAGAG GGG (reversed) Intergenic
No off target data available for this crispr