ID: 1167703664

View in Genome Browser
Species Human (GRCh38)
Location 19:51065763-51065785
Sequence CTGAGCCACTGGGGGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703664_1167703682 24 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703682 19:51065810-51065832 CCTGGGCTTGGCCCTCTGCTTGG No data
1167703664_1167703672 -8 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703664_1167703673 6 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703664_1167703674 7 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703674 19:51065793-51065815 TCTCCAGGCACCCCCGACCTGGG No data
1167703664_1167703683 25 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703664_1167703684 26 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703684 19:51065812-51065834 TGGGCTTGGCCCTCTGCTTGGGG No data
1167703664_1167703676 12 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703676 19:51065798-51065820 AGGCACCCCCGACCTGGGCTTGG No data
1167703664_1167703685 29 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703685 19:51065815-51065837 GCTTGGCCCTCTGCTTGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703664 Original CRISPR CTGAGCCACTGGGGGTGGAG AGG (reversed) Intergenic