ID: 1167703666

View in Genome Browser
Species Human (GRCh38)
Location 19:51065767-51065789
Sequence TCCACCCCCAGTGGCTCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703658_1167703666 -8 Left 1167703658 19:51065752-51065774 CCTGGCCTCCCCCTCTCCACCCC No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703651_1167703666 19 Left 1167703651 19:51065725-51065747 CCCCAGCTCACTCAGCATTTCCT No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703650_1167703666 20 Left 1167703650 19:51065724-51065746 CCCCCAGCTCACTCAGCATTTCC No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703657_1167703666 -7 Left 1167703657 19:51065751-51065773 CCCTGGCCTCCCCCTCTCCACCC No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703653_1167703666 17 Left 1167703653 19:51065727-51065749 CCAGCTCACTCAGCATTTCCTGG No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703649_1167703666 23 Left 1167703649 19:51065721-51065743 CCTCCCCCAGCTCACTCAGCATT No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703656_1167703666 -1 Left 1167703656 19:51065745-51065767 CCTGGTCCCTGGCCTCCCCCTCT No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703648_1167703666 24 Left 1167703648 19:51065720-51065742 CCCTCCCCCAGCTCACTCAGCAT No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data
1167703652_1167703666 18 Left 1167703652 19:51065726-51065748 CCCAGCTCACTCAGCATTTCCTG No data
Right 1167703666 19:51065767-51065789 TCCACCCCCAGTGGCTCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703666 Original CRISPR TCCACCCCCAGTGGCTCAGC GGG Intergenic
No off target data available for this crispr