ID: 1167703667

View in Genome Browser
Species Human (GRCh38)
Location 19:51065768-51065790
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703667_1167703685 24 Left 1167703667 19:51065768-51065790 CCACCCCCAGTGGCTCAGCGGGA No data
Right 1167703685 19:51065815-51065837 GCTTGGCCCTCTGCTTGGGGCGG No data
1167703667_1167703674 2 Left 1167703667 19:51065768-51065790 CCACCCCCAGTGGCTCAGCGGGA No data
Right 1167703674 19:51065793-51065815 TCTCCAGGCACCCCCGACCTGGG No data
1167703667_1167703684 21 Left 1167703667 19:51065768-51065790 CCACCCCCAGTGGCTCAGCGGGA No data
Right 1167703684 19:51065812-51065834 TGGGCTTGGCCCTCTGCTTGGGG No data
1167703667_1167703682 19 Left 1167703667 19:51065768-51065790 CCACCCCCAGTGGCTCAGCGGGA No data
Right 1167703682 19:51065810-51065832 CCTGGGCTTGGCCCTCTGCTTGG No data
1167703667_1167703683 20 Left 1167703667 19:51065768-51065790 CCACCCCCAGTGGCTCAGCGGGA No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703667_1167703676 7 Left 1167703667 19:51065768-51065790 CCACCCCCAGTGGCTCAGCGGGA No data
Right 1167703676 19:51065798-51065820 AGGCACCCCCGACCTGGGCTTGG No data
1167703667_1167703673 1 Left 1167703667 19:51065768-51065790 CCACCCCCAGTGGCTCAGCGGGA No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703667 Original CRISPR TCCCGCTGAGCCACTGGGGG TGG (reversed) Intergenic
No off target data available for this crispr