ID: 1167703671

View in Genome Browser
Species Human (GRCh38)
Location 19:51065774-51065796
Sequence GAGACATCCCGCTGAGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703671_1167703683 14 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703671_1167703688 28 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data
1167703671_1167703682 13 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703682 19:51065810-51065832 CCTGGGCTTGGCCCTCTGCTTGG No data
1167703671_1167703685 18 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703685 19:51065815-51065837 GCTTGGCCCTCTGCTTGGGGCGG No data
1167703671_1167703673 -5 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703671_1167703684 15 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703684 19:51065812-51065834 TGGGCTTGGCCCTCTGCTTGGGG No data
1167703671_1167703676 1 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703676 19:51065798-51065820 AGGCACCCCCGACCTGGGCTTGG No data
1167703671_1167703674 -4 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703674 19:51065793-51065815 TCTCCAGGCACCCCCGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703671 Original CRISPR GAGACATCCCGCTGAGCCAC TGG (reversed) Intergenic
No off target data available for this crispr